Mutagenetix > Incidental Mutation

Incidental Mutation 'R4840:Igfn1'

371688

Institutional Source

Beutler Lab

Gene Symbol

Igfn1

Ensembl Gene

ENSMUSG00000051985

Gene Name

immunoglobulin-like and fibronectin type III domain containing 1

Synonyms

9830123M21Rik

MMRRC Submission

042453-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R4840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135953578-136006342 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 135968040 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1596 (G1596D)

Ref Sequence

ENSEMBL: ENSMUSP00000129680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166193]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000124134

SMART Domains

Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985

Domain	Start	End	E-Value	Type
IG	73	159	1.29e-6	SMART
IG_like	258	344	5.45e1	SMART
IG	354	435	1.79e0	SMART
IG	445	524	3.54e-4	SMART
IG	538	624	4.86e-2	SMART
FN3	627	711	3.99e-10	SMART
FN3	727	810	9.1e-14	SMART
FN3	828	911	1.5e-14	SMART
IG	938	1021	6.41e-2	SMART
FN3	1024	1106	3.2e-9	SMART
IGc2	1152	1219	4.89e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140703

Predicted Effect

probably benign
Transcript: ENSMUST00000166193
AA Change: G1596D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: G1596D

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
IG	193	279	1.29e-6	SMART
PDB:2LHU\|A	302	365	8e-7	PDB
IG_like	378	464	5.45e1	SMART
IG	474	555	1.79e0	SMART
low complexity region	724	739	N/A	INTRINSIC
internal_repeat_2	838	1006	9.98e-5	PROSPERO
low complexity region	1067	1084	N/A	INTRINSIC
internal_repeat_2	1812	1967	9.98e-5	PROSPERO
Pfam:I-set	2054	2139	6.2e-8	PFAM
IG	2153	2239	4.86e-2	SMART
FN3	2242	2326	3.99e-10	SMART
FN3	2342	2425	9.1e-14	SMART
FN3	2443	2526	1.5e-14	SMART
IG	2553	2636	6.41e-2	SMART
FN3	2639	2721	3.2e-9	SMART
IGc2	2767	2834	4.89e-7	SMART

Meta Mutation Damage Score

0.1196

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

97% (114/117)

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	C	A	1: 86,046,444	T161K	probably benign	Het
Actn3	G	A	19: 4,864,511	R530W	probably damaging	Het
Alg11	C	T	8: 22,068,010	A404V	possibly damaging	Het
Alkbh8	T	A	9: 3,369,751	V340D	probably damaging	Het
Arhgef12	T	C	9: 42,975,068	H1166R	probably benign	Het
Aspm	T	A	1: 139,470,531	D978E	possibly damaging	Het
Bod1l	C	T	5: 41,818,472	G1833D	probably damaging	Het
Brd3	A	G	2: 27,449,239	V676A	possibly damaging	Het
Brip1	G	A	11: 86,146,183	T454I	possibly damaging	Het
C3ar1	T	C	6: 122,850,764	I165V	probably benign	Het
C87977	T	C	4: 144,208,574	K199R	probably damaging	Het
Camta1	T	A	4: 151,144,407	Q656L	probably benign	Het
Casp14	A	T	10: 78,713,344	L256*	probably null	Het
Cdh23	G	T	10: 60,419,777	H773Q	possibly damaging	Het
Chd1	G	A	17: 15,768,753	W1589*	probably null	Het
Chd1	G	T	17: 15,768,754	D1590Y	probably damaging	Het
Cldn19	A	G	4: 119,255,754	Q61R	probably damaging	Het
Cyp2a22	A	G	7: 26,932,524	S436P	probably benign	Het
E130218I03Rik	A	G	4: 134,245,276		probably benign	Het
Emc10	A	C	7: 44,492,627	V124G	probably damaging	Het
Enam	A	T	5: 88,503,026	D723V	probably benign	Het
Eps8	C	A	6: 137,527,130	Q158H	probably damaging	Het
Ercc6	G	A	14: 32,541,296	D486N	probably damaging	Het
Fasn	T	C	11: 120,813,059	E1485G	possibly damaging	Het
Fat2	T	C	11: 55,279,018	K2972E	probably benign	Het
Fbxw28	T	C	9: 109,339,534	K30R	probably null	Het
Flot2	T	A	11: 78,057,513	L164Q	probably damaging	Het
Fsip2	A	T	2: 82,949,395	I162L	probably benign	Het
Fsip2	A	T	2: 82,985,471	L3849F	probably benign	Het
Gabrb1	C	G	5: 71,700,811	P60R	probably damaging	Het
Galnt14	T	C	17: 73,504,898	R443G	probably benign	Het
Gas8	C	T	8: 123,531,014	T400M	probably benign	Het
Gfap	T	C	11: 102,894,388	Y254C	probably damaging	Het
Git2	A	G	5: 114,745,482	S396P	probably damaging	Het
Glb1l3	A	T	9: 26,829,053	M327K	probably benign	Het
Gm10715	A	C	9: 3,038,062		probably benign	Het
Gm10787	G	A	10: 77,022,007		noncoding transcript	Het
Gm1123	T	A	9: 99,018,569	D78V	probably damaging	Het
Gm27013	T	C	6: 130,678,116	T128A	probably benign	Het
Gm8979	T	C	7: 106,081,420		noncoding transcript	Het
Gpbp1	A	G	13: 111,440,630		probably null	Het
Gphn	G	A	12: 78,522,955		probably null	Het
Gpr157	A	G	4: 150,102,366	E317G	probably benign	Het
Gsdmc4	T	A	15: 63,893,747	M318L	probably benign	Het
Gtf2f2	A	T	14: 76,010,691	W19R	probably damaging	Het
Helb	A	G	10: 120,084,858	V1060A	probably benign	Het
Il1rl2	T	C	1: 40,327,387	I27T	possibly damaging	Het
Inpp5j	A	G	11: 3,499,676	V702A	probably damaging	Het
Kmt2d	A	C	15: 98,861,894	V1161G	unknown	Het
Krtap1-3	T	G	11: 99,590,889	Y144S	possibly damaging	Het
Layn	C	T	9: 51,057,382	V354M	probably damaging	Het
Lrba	G	A	3: 86,619,509		probably null	Het
Lrp8	T	A	4: 107,870,037	L893Q	possibly damaging	Het
Mrps9	T	A	1: 42,898,415		probably benign	Het
Mug1	T	A	6: 121,885,854	M1387K	probably damaging	Het
Myo18b	A	C	5: 112,874,029	V499G	probably benign	Het
Nbea	T	C	3: 55,710,670	E2321G	probably benign	Het
Nrsn2	C	T	2: 152,369,632	V160I	probably benign	Het
Nup210	G	A	6: 91,031,668	Q510*	probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr693	T	G	7: 106,678,123	D121A	probably damaging	Het
P3h3	G	T	6: 124,850,637	Q479K	possibly damaging	Het
Paqr9	T	A	9: 95,560,670	F238I	probably damaging	Het
Parp3	A	T	9: 106,473,109	L343H	probably damaging	Het
Pcdh18	A	C	3: 49,744,668	M1115R	probably damaging	Het
Pcdh8	A	G	14: 79,770,868	V85A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,399	N254S	possibly damaging	Het
Pld1	T	C	3: 28,076,551	V500A	probably benign	Het
Prkg2	A	T	5: 98,981,143	D311E	probably benign	Het
Prss42	T	C	9: 110,799,301	L171P	probably damaging	Het
Pth2	T	A	7: 45,181,343	L17H	probably damaging	Het
Reln	A	T	5: 22,018,846		probably null	Het
Rmi2	G	T	16: 10,839,837	V104L	probably damaging	Het
Rpusd4	T	A	9: 35,268,535	V108D	probably damaging	Het
Rufy4	C	A	1: 74,129,039	T82K	possibly damaging	Het
Scimp	G	A	11: 70,791,468	Q141*	probably null	Het
Sel1l2	T	C	2: 140,263,470	T267A	probably benign	Het
Sema5a	T	A	15: 32,550,254	S146R	possibly damaging	Het
Sh2d3c	T	C	2: 32,721,160	M1T	probably null	Het
Slc30a6	T	C	17: 74,405,721	L71P	probably damaging	Het
Srrm3	A	G	5: 135,854,595	Y224C	possibly damaging	Het
Tacr3	A	T	3: 134,854,854	T185S	possibly damaging	Het
Tas2r140	T	A	6: 133,055,565	T77S	probably benign	Het
Thsd7b	T	C	1: 129,595,844	V128A	probably benign	Het
Tnfrsf10b	T	G	14: 69,776,159	H179Q	probably damaging	Het
Tonsl	A	G	15: 76,633,209	V770A	probably benign	Het
Trim42	G	A	9: 97,362,929	P606L	probably benign	Het
Trim45	A	T	3: 100,925,488	T346S	possibly damaging	Het
Ttc28	C	A	5: 111,286,081	S2296Y	probably damaging	Het
Ttc41	C	T	10: 86,731,125	R552C	probably benign	Het
Tube1	A	G	10: 39,144,846	N243D	probably benign	Het
Tvp23b	G	T	11: 62,879,598		probably null	Het
Ubxn11	T	A	4: 134,109,608	I49N	probably damaging	Het
Usp17le	T	A	7: 104,769,770	E55V	probably benign	Het
Vmn2r114	A	T	17: 23,291,379	V709D	probably damaging	Het
Vmn2r23	C	T	6: 123,713,074	T303M	probably damaging	Het
Vmn2r60	C	T	7: 42,135,861	P166S	probably damaging	Het
Vmn2r83	A	G	10: 79,477,848	I97V	possibly damaging	Het
Vmn2r-ps159	G	C	4: 156,333,438		noncoding transcript	Het
Wbp2nl	A	T	15: 82,314,336	K358M	possibly damaging	Het
Xpo1	T	A	11: 23,278,183	I150N	probably damaging	Het
Zfp113	G	A	5: 138,145,425	L188F	probably damaging	Het
Zfp189	T	G	4: 49,529,984	S362R	probably damaging	Het

Other mutations in Igfn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Igfn1	APN	1	135966726	missense	probably damaging	1.00
IGL02299:Igfn1	APN	1	135954017	utr 3 prime	probably benign
Bounty	UTSW	1	135976917	critical splice donor site	probably null
R2276_Igfn1_773	UTSW	1	135964741	missense	probably damaging	0.98
R4058_Igfn1_315	UTSW	1	135969756	missense	probably benign	0.07
R0144:Igfn1	UTSW	1	135962013	missense	probably damaging	0.99
R0190:Igfn1	UTSW	1	135962052	missense	probably damaging	1.00
R0350:Igfn1	UTSW	1	135956767	nonsense	probably null
R0413:Igfn1	UTSW	1	135967596	missense	probably benign	0.23
R0504:Igfn1	UTSW	1	135968529	missense	probably benign	0.00
R0606:Igfn1	UTSW	1	135959901	missense	probably damaging	1.00
R0681:Igfn1	UTSW	1	135963853	missense	possibly damaging	0.88
R0825:Igfn1	UTSW	1	135963126	missense	probably damaging	1.00
R0839:Igfn1	UTSW	1	135954680	missense	probably damaging	1.00
R1066:Igfn1	UTSW	1	135970725	missense	probably benign
R1078:Igfn1	UTSW	1	135974847	missense	probably damaging	1.00
R1224:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R1569:Igfn1	UTSW	1	135969033	missense	probably benign
R1626:Igfn1	UTSW	1	135968967	missense	probably benign	0.29
R1663:Igfn1	UTSW	1	135968308	missense	probably benign	0.15
R1677:Igfn1	UTSW	1	135971101	missense	probably damaging	0.99
R1709:Igfn1	UTSW	1	135955573	missense	probably benign	0.24
R1728:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1728:Igfn1	UTSW	1	135968199	missense	probably benign
R1728:Igfn1	UTSW	1	135970411	missense	probably benign
R1728:Igfn1	UTSW	1	135972127	missense	probably benign
R1728:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1728:Igfn1	UTSW	1	135982475	missense	probably benign
R1728:Igfn1	UTSW	1	135998625	missense	probably benign
R1728:Igfn1	UTSW	1	135998683	missense	unknown
R1729:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1729:Igfn1	UTSW	1	135968199	missense	probably benign
R1729:Igfn1	UTSW	1	135970411	missense	probably benign
R1729:Igfn1	UTSW	1	135972127	missense	probably benign
R1729:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1729:Igfn1	UTSW	1	135982475	missense	probably benign
R1729:Igfn1	UTSW	1	135998625	missense	probably benign
R1729:Igfn1	UTSW	1	135998683	missense	unknown
R1730:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1730:Igfn1	UTSW	1	135968199	missense	probably benign
R1730:Igfn1	UTSW	1	135970411	missense	probably benign
R1730:Igfn1	UTSW	1	135972127	missense	probably benign
R1730:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1730:Igfn1	UTSW	1	135982475	missense	probably benign
R1730:Igfn1	UTSW	1	135998625	missense	probably benign
R1730:Igfn1	UTSW	1	135998683	missense	unknown
R1739:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1739:Igfn1	UTSW	1	135968199	missense	probably benign
R1739:Igfn1	UTSW	1	135970411	missense	probably benign
R1739:Igfn1	UTSW	1	135972127	missense	probably benign
R1739:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1739:Igfn1	UTSW	1	135982475	missense	probably benign
R1739:Igfn1	UTSW	1	135998625	missense	probably benign
R1739:Igfn1	UTSW	1	135998683	missense	unknown
R1746:Igfn1	UTSW	1	135969823	missense	possibly damaging	0.88
R1762:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1762:Igfn1	UTSW	1	135968199	missense	probably benign
R1762:Igfn1	UTSW	1	135970411	missense	probably benign
R1762:Igfn1	UTSW	1	135972127	missense	probably benign
R1762:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1762:Igfn1	UTSW	1	135982475	missense	probably benign
R1762:Igfn1	UTSW	1	135998625	missense	probably benign
R1762:Igfn1	UTSW	1	135998683	missense	unknown
R1783:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1783:Igfn1	UTSW	1	135968199	missense	probably benign
R1783:Igfn1	UTSW	1	135970411	missense	probably benign
R1783:Igfn1	UTSW	1	135972127	missense	probably benign
R1783:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1783:Igfn1	UTSW	1	135982475	missense	probably benign
R1783:Igfn1	UTSW	1	135998625	missense	probably benign
R1783:Igfn1	UTSW	1	135998683	missense	unknown
R1784:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1784:Igfn1	UTSW	1	135968199	missense	probably benign
R1784:Igfn1	UTSW	1	135970411	missense	probably benign
R1784:Igfn1	UTSW	1	135972127	missense	probably benign
R1784:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1784:Igfn1	UTSW	1	135982475	missense	probably benign
R1784:Igfn1	UTSW	1	135998625	missense	probably benign
R1784:Igfn1	UTSW	1	135998683	missense	unknown
R1785:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1785:Igfn1	UTSW	1	135968199	missense	probably benign
R1785:Igfn1	UTSW	1	135970411	missense	probably benign
R1785:Igfn1	UTSW	1	135972127	missense	probably benign
R1785:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1785:Igfn1	UTSW	1	135982475	missense	probably benign
R1785:Igfn1	UTSW	1	135998625	missense	probably benign
R1785:Igfn1	UTSW	1	135998683	missense	unknown
R1847:Igfn1	UTSW	1	135969388	missense	probably benign
R1866:Igfn1	UTSW	1	135974868	splice site	probably null
R1921:Igfn1	UTSW	1	135966063	critical splice donor site	probably null
R1984:Igfn1	UTSW	1	135962044	missense	probably benign	0.39
R2049:Igfn1	UTSW	1	135970638	missense	probably benign
R2049:Igfn1	UTSW	1	135974852	splice site	probably benign
R2098:Igfn1	UTSW	1	135978305	missense	probably damaging	1.00
R2130:Igfn1	UTSW	1	135974852	splice site	probably benign
R2141:Igfn1	UTSW	1	135974852	splice site	probably benign
R2276:Igfn1	UTSW	1	135964741	missense	probably damaging	0.98
R2425:Igfn1	UTSW	1	135963102	missense	probably damaging	1.00
R2483:Igfn1	UTSW	1	135969537	missense	probably benign
R2504:Igfn1	UTSW	1	135969316	missense	probably benign	0.07
R3109:Igfn1	UTSW	1	135997848	missense	probably benign	0.12
R3421:Igfn1	UTSW	1	135976917	critical splice donor site	probably null
R3423:Igfn1	UTSW	1	135998641	missense	probably benign	0.01
R3705:Igfn1	UTSW	1	135968409	missense	probably benign
R3871:Igfn1	UTSW	1	135968836	missense	probably benign	0.03
R3875:Igfn1	UTSW	1	135954614	missense	probably damaging	1.00
R3953:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3955:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3957:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3965:Igfn1	UTSW	1	135967819	missense	probably benign
R4006:Igfn1	UTSW	1	135982362	splice site	probably null
R4058:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4059:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4370:Igfn1	UTSW	1	135968106	missense	probably benign	0.00
R4380:Igfn1	UTSW	1	135967771	missense	probably benign	0.00
R4495:Igfn1	UTSW	1	135969678	missense	possibly damaging	0.79
R4628:Igfn1	UTSW	1	135959730	missense	possibly damaging	0.47
R4672:Igfn1	UTSW	1	135965369	missense	possibly damaging	0.72
R4682:Igfn1	UTSW	1	135998625	missense	probably benign
R4702:Igfn1	UTSW	1	135967209	missense	possibly damaging	0.71
R4744:Igfn1	UTSW	1	135982458	missense	probably benign	0.07
R4777:Igfn1	UTSW	1	135954862	missense	probably benign
R4806:Igfn1	UTSW	1	135967357	missense	probably benign	0.01
R4894:Igfn1	UTSW	1	135954782	missense	probably damaging	1.00
R4998:Igfn1	UTSW	1	135954666	missense	probably damaging	1.00
R5092:Igfn1	UTSW	1	135964826	missense	probably benign
R5108:Igfn1	UTSW	1	135982441	missense	probably benign
R5120:Igfn1	UTSW	1	135973502	missense	possibly damaging	0.93
R5127:Igfn1	UTSW	1	135959896	missense	probably damaging	1.00
R5231:Igfn1	UTSW	1	135966736	missense	probably benign	0.26
R5286:Igfn1	UTSW	1	135967861	missense	probably benign	0.10
R5307:Igfn1	UTSW	1	135964938	missense	probably damaging	1.00
R5380:Igfn1	UTSW	1	135966087	missense	probably damaging	1.00
R5553:Igfn1	UTSW	1	135967884	missense	probably damaging	1.00
R5660:Igfn1	UTSW	1	135970414	missense	probably benign	0.01
R5779:Igfn1	UTSW	1	135966840	missense	probably benign	0.16
R5818:Igfn1	UTSW	1	135966126	missense	possibly damaging	0.72
R5832:Igfn1	UTSW	1	135974795	missense	probably damaging	0.96
R5933:Igfn1	UTSW	1	135970603	nonsense	probably null
R5966:Igfn1	UTSW	1	135965414	missense	probably damaging	1.00
R6116:Igfn1	UTSW	1	135970467	missense	probably benign	0.00
R6297:Igfn1	UTSW	1	135964661	critical splice donor site	probably null
R6652:Igfn1	UTSW	1	135963871	missense	probably damaging	1.00
R6737:Igfn1	UTSW	1	135969867	missense	probably benign
R6816:Igfn1	UTSW	1	135959728	missense	probably benign	0.02
R6886:Igfn1	UTSW	1	135973460	missense	probably damaging	1.00
R6888:Igfn1	UTSW	1	135982480	missense	probably benign	0.33
R6975:Igfn1	UTSW	1	135968445	missense	probably damaging	0.96
R7105:Igfn1	UTSW	1	135984218	missense	probably benign	0.11
R7114:Igfn1	UTSW	1	135966781	missense	probably benign	0.01
R7233:Igfn1	UTSW	1	135970135	missense	probably benign	0.41
R7276:Igfn1	UTSW	1	135998638	missense	possibly damaging	0.85
R7354:Igfn1	UTSW	1	135976032	missense	possibly damaging	0.72
R7358:Igfn1	UTSW	1	135964000	missense	probably damaging	1.00
R7380:Igfn1	UTSW	1	135962008	missense	probably damaging	1.00
R7389:Igfn1	UTSW	1	135967047	missense	probably benign	0.00
R7513:Igfn1	UTSW	1	135959967	missense	probably damaging	1.00
R7718:Igfn1	UTSW	1	135969036	missense	probably benign
R7769:Igfn1	UTSW	1	135982405	missense	possibly damaging	0.85
R7810:Igfn1	UTSW	1	135974789	missense	probably damaging	0.98
R7917:Igfn1	UTSW	1	135971968	missense	probably damaging	0.99
R7952:Igfn1	UTSW	1	135963955	missense	probably damaging	0.99
R8041:Igfn1	UTSW	1	135968059	nonsense	probably null
R8233:Igfn1	UTSW	1	135968044	missense	probably benign	0.00
R8354:Igfn1	UTSW	1	135959881	missense	possibly damaging	0.61
R8363:Igfn1	UTSW	1	135963887	missense	probably benign	0.01
R8428:Igfn1	UTSW	1	135967782	missense	probably damaging	1.00
R8731:Igfn1	UTSW	1	135997836	missense	probably benign	0.02
R8756:Igfn1	UTSW	1	135967960	missense	probably benign	0.10
R8797:Igfn1	UTSW	1	135974835	missense	possibly damaging	0.93
R8913:Igfn1	UTSW	1	135963841	missense	possibly damaging	0.90
R8927:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R8928:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R9087:Igfn1	UTSW	1	135974868	splice site	probably null
R9109:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9113:Igfn1	UTSW	1	135955590	missense	probably damaging	1.00
R9117:Igfn1	UTSW	1	135974790	missense	probably benign	0.03
R9205:Igfn1	UTSW	1	135975957	missense	probably damaging	0.96
R9251:Igfn1	UTSW	1	135966671	splice site	probably benign
R9260:Igfn1	UTSW	1	135979956	missense	probably benign	0.45
R9275:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9277:Igfn1	UTSW	1	135959782	missense	probably damaging	0.98
R9278:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9287:Igfn1	UTSW	1	135997806	missense	probably benign	0.33
R9298:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9356:Igfn1	UTSW	1	135972087	nonsense	probably null
R9371:Igfn1	UTSW	1	135978263	missense	probably damaging	1.00
R9532:Igfn1	UTSW	1	135969491	missense	possibly damaging	0.61
R9653:Igfn1	UTSW	1	135955585	nonsense	probably null
R9666:Igfn1	UTSW	1	135969954	missense	possibly damaging	0.65
R9741:Igfn1	UTSW	1	135967645	missense	probably benign	0.00
R9748:Igfn1	UTSW	1	135998598	missense	possibly damaging	0.89
R9796:Igfn1	UTSW	1	135969873	missense	probably benign	0.26
Z1176:Igfn1	UTSW	1	135972000	missense	probably damaging	0.99
Z1177:Igfn1	UTSW	1	135955809	missense	probably damaging	1.00
Z1177:Igfn1	UTSW	1	135969567	missense	probably benign	0.26
Z1177:Igfn1	UTSW	1	135982426	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GGAACCCAGAATCATCTTTCCATTC -3'
(R):5'- CTTGCAGATGGTTCAGGGAG -3'

Sequencing Primer
(F):5'- CTCTGATACCTGGTTTCCCCACAG -3'
(R):5'- CTAGGAGGACCAGGGTCACTG -3'

Posted On

2016-03-01