Mutagenetix > Incidental Mutation

Incidental Mutation 'R4840:Ttc28'

371715

Institutional Source

Beutler Lab

Gene Symbol

Ttc28

Ensembl Gene

ENSMUSG00000033209

Gene Name

tetratricopeptide repeat domain 28

Synonyms

MMRRC Submission

042453-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110879803-111289780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 111286081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Tyrosine at position 2296 (S2296Y)

Ref Sequence

ENSEMBL: ENSMUSP00000137609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]

AlphaFold

Q80XJ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000040111
AA Change: S2327Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: S2327Y

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	339	372	1.78e-1	SMART
TPR	379	412	2.82e-4	SMART
TPR	419	452	9.98e-5	SMART
TPR	459	492	1.88e0	SMART
TPR	499	532	1.11e1	SMART
TPR	539	572	2.93e-2	SMART
TPR	579	612	1.21e-3	SMART
TPR	619	652	4.91e-4	SMART
TPR	659	692	7.56e-5	SMART
TPR	699	732	8.29e0	SMART
TPR	739	772	1.63e0	SMART
TPR	779	812	1.24e0	SMART
TPR	819	852	7.98e-4	SMART
TPR	859	892	8.74e0	SMART
TPR	902	935	5.43e-6	SMART
TPR	942	975	4.09e-1	SMART
TPR	982	1015	9.98e-5	SMART
TPR	1022	1055	7.12e-1	SMART
TPR	1062	1095	5.69e0	SMART
TPR	1102	1135	3.14e-2	SMART
TPR	1142	1175	2.84e1	SMART
low complexity region	1259	1277	N/A	INTRINSIC
Pfam:CHAT	1415	1738	7.3e-77	PFAM
low complexity region	1972	1990	N/A	INTRINSIC
low complexity region	2014	2031	N/A	INTRINSIC
low complexity region	2033	2045	N/A	INTRINSIC
low complexity region	2155	2171	N/A	INTRINSIC
low complexity region	2283	2293	N/A	INTRINSIC
low complexity region	2327	2352	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156290
AA Change: S2296Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: S2296Y

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	308	341	1.78e-1	SMART
TPR	348	381	2.82e-4	SMART
TPR	388	421	9.98e-5	SMART
TPR	428	461	1.88e0	SMART
TPR	468	501	1.11e1	SMART
TPR	508	541	2.93e-2	SMART
TPR	548	581	1.21e-3	SMART
TPR	588	621	4.91e-4	SMART
TPR	628	661	7.56e-5	SMART
TPR	668	701	8.29e0	SMART
TPR	708	741	1.63e0	SMART
TPR	748	781	1.24e0	SMART
TPR	788	821	7.98e-4	SMART
TPR	828	861	8.74e0	SMART
TPR	871	904	5.43e-6	SMART
TPR	911	944	4.09e-1	SMART
TPR	951	984	9.98e-5	SMART
TPR	991	1024	7.12e-1	SMART
TPR	1031	1064	5.69e0	SMART
TPR	1071	1104	3.14e-2	SMART
TPR	1111	1144	2.84e1	SMART
low complexity region	1228	1246	N/A	INTRINSIC
Pfam:CHAT	1384	1707	1.1e-76	PFAM
low complexity region	1941	1959	N/A	INTRINSIC
low complexity region	1983	2000	N/A	INTRINSIC
low complexity region	2002	2014	N/A	INTRINSIC
low complexity region	2124	2140	N/A	INTRINSIC
low complexity region	2252	2262	N/A	INTRINSIC
low complexity region	2296	2321	N/A	INTRINSIC

Meta Mutation Damage Score

0.1585

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

97% (114/117)

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	C	A	1: 86,046,444	T161K	probably benign	Het
Actn3	G	A	19: 4,864,511	R530W	probably damaging	Het
Alg11	C	T	8: 22,068,010	A404V	possibly damaging	Het
Alkbh8	T	A	9: 3,369,751	V340D	probably damaging	Het
Arhgef12	T	C	9: 42,975,068	H1166R	probably benign	Het
Aspm	T	A	1: 139,470,531	D978E	possibly damaging	Het
Bod1l	C	T	5: 41,818,472	G1833D	probably damaging	Het
Brd3	A	G	2: 27,449,239	V676A	possibly damaging	Het
Brip1	G	A	11: 86,146,183	T454I	possibly damaging	Het
C3ar1	T	C	6: 122,850,764	I165V	probably benign	Het
C87977	T	C	4: 144,208,574	K199R	probably damaging	Het
Camta1	T	A	4: 151,144,407	Q656L	probably benign	Het
Casp14	A	T	10: 78,713,344	L256*	probably null	Het
Cdh23	G	T	10: 60,419,777	H773Q	possibly damaging	Het
Chd1	G	A	17: 15,768,753	W1589*	probably null	Het
Chd1	G	T	17: 15,768,754	D1590Y	probably damaging	Het
Cldn19	A	G	4: 119,255,754	Q61R	probably damaging	Het
Cyp2a22	A	G	7: 26,932,524	S436P	probably benign	Het
E130218I03Rik	A	G	4: 134,245,276		probably benign	Het
Emc10	A	C	7: 44,492,627	V124G	probably damaging	Het
Enam	A	T	5: 88,503,026	D723V	probably benign	Het
Eps8	C	A	6: 137,527,130	Q158H	probably damaging	Het
Ercc6	G	A	14: 32,541,296	D486N	probably damaging	Het
Fasn	T	C	11: 120,813,059	E1485G	possibly damaging	Het
Fat2	T	C	11: 55,279,018	K2972E	probably benign	Het
Fbxw28	T	C	9: 109,339,534	K30R	probably null	Het
Flot2	T	A	11: 78,057,513	L164Q	probably damaging	Het
Fsip2	A	T	2: 82,949,395	I162L	probably benign	Het
Fsip2	A	T	2: 82,985,471	L3849F	probably benign	Het
Gabrb1	C	G	5: 71,700,811	P60R	probably damaging	Het
Galnt14	T	C	17: 73,504,898	R443G	probably benign	Het
Gas8	C	T	8: 123,531,014	T400M	probably benign	Het
Gfap	T	C	11: 102,894,388	Y254C	probably damaging	Het
Git2	A	G	5: 114,745,482	S396P	probably damaging	Het
Glb1l3	A	T	9: 26,829,053	M327K	probably benign	Het
Gm10715	A	C	9: 3,038,062		probably benign	Het
Gm10787	G	A	10: 77,022,007		noncoding transcript	Het
Gm1123	T	A	9: 99,018,569	D78V	probably damaging	Het
Gm27013	T	C	6: 130,678,116	T128A	probably benign	Het
Gm8979	T	C	7: 106,081,420		noncoding transcript	Het
Gpbp1	A	G	13: 111,440,630		probably null	Het
Gphn	G	A	12: 78,522,955		probably null	Het
Gpr157	A	G	4: 150,102,366	E317G	probably benign	Het
Gsdmc4	T	A	15: 63,893,747	M318L	probably benign	Het
Gtf2f2	A	T	14: 76,010,691	W19R	probably damaging	Het
Helb	A	G	10: 120,084,858	V1060A	probably benign	Het
Igfn1	C	T	1: 135,968,040	G1596D	probably benign	Het
Il1rl2	T	C	1: 40,327,387	I27T	possibly damaging	Het
Inpp5j	A	G	11: 3,499,676	V702A	probably damaging	Het
Kmt2d	A	C	15: 98,861,894	V1161G	unknown	Het
Krtap1-3	T	G	11: 99,590,889	Y144S	possibly damaging	Het
Layn	C	T	9: 51,057,382	V354M	probably damaging	Het
Lrba	G	A	3: 86,619,509		probably null	Het
Lrp8	T	A	4: 107,870,037	L893Q	possibly damaging	Het
Mrps9	T	A	1: 42,898,415		probably benign	Het
Mug1	T	A	6: 121,885,854	M1387K	probably damaging	Het
Myo18b	A	C	5: 112,874,029	V499G	probably benign	Het
Nbea	T	C	3: 55,710,670	E2321G	probably benign	Het
Nrsn2	C	T	2: 152,369,632	V160I	probably benign	Het
Nup210	G	A	6: 91,031,668	Q510*	probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr693	T	G	7: 106,678,123	D121A	probably damaging	Het
P3h3	G	T	6: 124,850,637	Q479K	possibly damaging	Het
Paqr9	T	A	9: 95,560,670	F238I	probably damaging	Het
Parp3	A	T	9: 106,473,109	L343H	probably damaging	Het
Pcdh18	A	C	3: 49,744,668	M1115R	probably damaging	Het
Pcdh8	A	G	14: 79,770,868	V85A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,399	N254S	possibly damaging	Het
Pld1	T	C	3: 28,076,551	V500A	probably benign	Het
Prkg2	A	T	5: 98,981,143	D311E	probably benign	Het
Prss42	T	C	9: 110,799,301	L171P	probably damaging	Het
Pth2	T	A	7: 45,181,343	L17H	probably damaging	Het
Reln	A	T	5: 22,018,846		probably null	Het
Rmi2	G	T	16: 10,839,837	V104L	probably damaging	Het
Rpusd4	T	A	9: 35,268,535	V108D	probably damaging	Het
Rufy4	C	A	1: 74,129,039	T82K	possibly damaging	Het
Scimp	G	A	11: 70,791,468	Q141*	probably null	Het
Sel1l2	T	C	2: 140,263,470	T267A	probably benign	Het
Sema5a	T	A	15: 32,550,254	S146R	possibly damaging	Het
Sh2d3c	T	C	2: 32,721,160	M1T	probably null	Het
Slc30a6	T	C	17: 74,405,721	L71P	probably damaging	Het
Srrm3	A	G	5: 135,854,595	Y224C	possibly damaging	Het
Tacr3	A	T	3: 134,854,854	T185S	possibly damaging	Het
Tas2r140	T	A	6: 133,055,565	T77S	probably benign	Het
Thsd7b	T	C	1: 129,595,844	V128A	probably benign	Het
Tnfrsf10b	T	G	14: 69,776,159	H179Q	probably damaging	Het
Tonsl	A	G	15: 76,633,209	V770A	probably benign	Het
Trim42	G	A	9: 97,362,929	P606L	probably benign	Het
Trim45	A	T	3: 100,925,488	T346S	possibly damaging	Het
Ttc41	C	T	10: 86,731,125	R552C	probably benign	Het
Tube1	A	G	10: 39,144,846	N243D	probably benign	Het
Tvp23b	G	T	11: 62,879,598		probably null	Het
Ubxn11	T	A	4: 134,109,608	I49N	probably damaging	Het
Usp17le	T	A	7: 104,769,770	E55V	probably benign	Het
Vmn2r114	A	T	17: 23,291,379	V709D	probably damaging	Het
Vmn2r23	C	T	6: 123,713,074	T303M	probably damaging	Het
Vmn2r60	C	T	7: 42,135,861	P166S	probably damaging	Het
Vmn2r83	A	G	10: 79,477,848	I97V	possibly damaging	Het
Vmn2r-ps159	G	C	4: 156,333,438		noncoding transcript	Het
Wbp2nl	A	T	15: 82,314,336	K358M	possibly damaging	Het
Xpo1	T	A	11: 23,278,183	I150N	probably damaging	Het
Zfp113	G	A	5: 138,145,425	L188F	probably damaging	Het
Zfp189	T	G	4: 49,529,984	S362R	probably damaging	Het

Other mutations in Ttc28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Ttc28	APN	5	111225688	missense	probably damaging	1.00
IGL00963:Ttc28	APN	5	111286389	nonsense	probably null
IGL00969:Ttc28	APN	5	111225740	missense	probably benign	0.00
IGL01366:Ttc28	APN	5	111085171	critical splice donor site	probably null
IGL01528:Ttc28	APN	5	111101960	splice site	probably benign
IGL01558:Ttc28	APN	5	111283962	missense	probably damaging	0.99
IGL01973:Ttc28	APN	5	111224235	missense	possibly damaging	0.88
IGL02040:Ttc28	APN	5	110892936	nonsense	probably null
IGL02432:Ttc28	APN	5	111223235	missense	probably damaging	1.00
IGL02531:Ttc28	APN	5	111225850	missense	probably damaging	1.00
IGL02819:Ttc28	APN	5	111266583	missense	probably benign
IGL02830:Ttc28	APN	5	111286239	missense	probably benign	0.10
IGL02893:Ttc28	APN	5	111285385	missense	possibly damaging	0.87
IGL03387:Ttc28	APN	5	111233342	missense	probably benign	0.07
PIT4131001:Ttc28	UTSW	5	110892853	missense	probably benign	0.00
R0142:Ttc28	UTSW	5	111277457	missense	probably benign	0.40
R0166:Ttc28	UTSW	5	111225634	missense	probably benign	0.01
R0328:Ttc28	UTSW	5	111284067	splice site	probably benign
R0582:Ttc28	UTSW	5	111183296	missense	probably damaging	1.00
R0744:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R0811:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0812:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0828:Ttc28	UTSW	5	111223446	missense	probably damaging	1.00
R0833:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R1013:Ttc28	UTSW	5	111276965	missense	probably benign	0.01
R1168:Ttc28	UTSW	5	111231111	missense	probably damaging	1.00
R1194:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1196:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1205:Ttc28	UTSW	5	111285769	missense	probably benign	0.04
R1386:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1537:Ttc28	UTSW	5	111285318	missense	probably damaging	0.96
R1539:Ttc28	UTSW	5	111100811	missense	possibly damaging	0.77
R1558:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1560:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1561:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1566:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1768:Ttc28	UTSW	5	111277168	missense	possibly damaging	0.77
R1775:Ttc28	UTSW	5	111276811	missense	probably benign	0.00
R1909:Ttc28	UTSW	5	111284054	critical splice donor site	probably null
R1911:Ttc28	UTSW	5	111280750	missense	possibly damaging	0.93
R1970:Ttc28	UTSW	5	111235635	missense	probably benign	0.00
R1990:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R1992:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R2066:Ttc28	UTSW	5	111225933	missense	probably benign	0.01
R2112:Ttc28	UTSW	5	111276273	missense	probably damaging	0.99
R2158:Ttc28	UTSW	5	111177617	intron	probably benign
R2192:Ttc28	UTSW	5	111223496	missense	probably damaging	0.99
R2267:Ttc28	UTSW	5	111226003	missense	possibly damaging	0.75
R2384:Ttc28	UTSW	5	111276208	missense	possibly damaging	0.95
R2989:Ttc28	UTSW	5	111224015	missense	probably benign	0.29
R3881:Ttc28	UTSW	5	111183240	missense	probably damaging	1.00
R3919:Ttc28	UTSW	5	111285379	missense	possibly damaging	0.80
R4455:Ttc28	UTSW	5	111224058	frame shift	probably null
R4456:Ttc28	UTSW	5	111224058	frame shift	probably null
R4522:Ttc28	UTSW	5	111280172	missense	probably benign	0.01
R4548:Ttc28	UTSW	5	111271224	missense	possibly damaging	0.86
R4591:Ttc28	UTSW	5	111223281	missense	probably damaging	1.00
R4633:Ttc28	UTSW	5	111224001	missense	probably damaging	1.00
R4700:Ttc28	UTSW	5	111277043	missense	probably damaging	1.00
R4714:Ttc28	UTSW	5	111285229	missense	possibly damaging	0.65
R4790:Ttc28	UTSW	5	111224217	missense	possibly damaging	0.94
R4803:Ttc28	UTSW	5	111277463	missense	possibly damaging	0.90
R4969:Ttc28	UTSW	5	111276255	missense	probably damaging	0.96
R5019:Ttc28	UTSW	5	111102064	missense	possibly damaging	0.47
R5130:Ttc28	UTSW	5	110892856	missense	probably benign
R5150:Ttc28	UTSW	5	111225689	missense	probably damaging	1.00
R5214:Ttc28	UTSW	5	111177623	intron	probably benign
R5254:Ttc28	UTSW	5	111271238	missense	probably benign	0.01
R5518:Ttc28	UTSW	5	111225928	missense	probably benign	0.17
R5851:Ttc28	UTSW	5	111235469	splice site	probably benign
R5931:Ttc28	UTSW	5	111085109	missense	possibly damaging	0.81
R6011:Ttc28	UTSW	5	111286443	missense	probably benign
R6176:Ttc28	UTSW	5	111223985	missense	probably damaging	1.00
R6221:Ttc28	UTSW	5	111271248	missense	probably benign	0.00
R6398:Ttc28	UTSW	5	111276276	missense	probably damaging	1.00
R6717:Ttc28	UTSW	5	111285436	missense	probably benign
R6770:Ttc28	UTSW	5	111286140	missense	probably damaging	1.00
R6901:Ttc28	UTSW	5	111277025	missense	possibly damaging	0.88
R7038:Ttc28	UTSW	5	111266579	missense	probably benign	0.09
R7073:Ttc28	UTSW	5	111223416	missense	possibly damaging	0.96
R7101:Ttc28	UTSW	5	111085092	missense	probably damaging	1.00
R7135:Ttc28	UTSW	5	111280007	missense	probably damaging	1.00
R7350:Ttc28	UTSW	5	111226037	missense	probably damaging	0.97
R7454:Ttc28	UTSW	5	111285484	missense	probably benign	0.19
R7461:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7596:Ttc28	UTSW	5	111280124	missense	probably damaging	1.00
R7613:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7625:Ttc28	UTSW	5	111285219	missense	possibly damaging	0.65
R7648:Ttc28	UTSW	5	111183392	missense	possibly damaging	0.52
R7735:Ttc28	UTSW	5	111266678	splice site	probably null
R8030:Ttc28	UTSW	5	111286056	missense	possibly damaging	0.81
R8205:Ttc28	UTSW	5	111225730	missense	possibly damaging	0.95
R8246:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8247:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8269:Ttc28	UTSW	5	111277459	missense	probably benign	0.09
R8292:Ttc28	UTSW	5	111223257	missense	probably damaging	1.00
R8346:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8356:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8423:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8424:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8426:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8441:Ttc28	UTSW	5	111177641	nonsense	probably null
R8494:Ttc28	UTSW	5	111235640	missense	probably damaging	0.96
R8508:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8510:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8729:Ttc28	UTSW	5	111235643	critical splice donor site	probably null
R8845:Ttc28	UTSW	5	111224175	missense	probably benign	0.11
R9003:Ttc28	UTSW	5	111277030	missense	probably benign	0.00
R9185:Ttc28	UTSW	5	111223476	missense	probably benign	0.03
R9187:Ttc28	UTSW	5	111102036	missense	probably damaging	1.00
R9245:Ttc28	UTSW	5	111177659	missense	unknown
R9251:Ttc28	UTSW	5	110892832	missense	possibly damaging	0.47
R9372:Ttc28	UTSW	5	111183207	missense	probably benign	0.25
R9466:Ttc28	UTSW	5	111183029	missense	probably damaging	0.99
R9563:Ttc28	UTSW	5	111223226	missense	probably benign	0.22
R9606:Ttc28	UTSW	5	111285274	missense	probably benign	0.00
R9691:Ttc28	UTSW	5	111284013	missense	probably benign	0.01
R9709:Ttc28	UTSW	5	111285771	missense	probably damaging	0.97
V8831:Ttc28	UTSW	5	111100712	missense	probably benign	0.11
Z1088:Ttc28	UTSW	5	111286315	missense	probably benign	0.00
Z1176:Ttc28	UTSW	5	111266566	missense	possibly damaging	0.59
Z1177:Ttc28	UTSW	5	111278586	missense	probably damaging	1.00
Z1177:Ttc28	UTSW	5	111285739	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TGTCGCCACTCACTGTCAAAC -3'
(R):5'- ACCTCGACATGTTTTCCGG -3'

Sequencing Primer
(F):5'- ATCTCTTCCCAAGGTGAGCAG -3'
(R):5'- ACATGTTTTCCGGGGGCC -3'

Posted On

2016-03-01