Mutagenetix > Incidental Mutation

Incidental Mutation 'R4840:Mug1'

371721

Institutional Source

Beutler Lab

Gene Symbol

Mug1

Ensembl Gene

ENSMUSG00000059908

Gene Name

murinoglobulin 1

Synonyms

MMRRC Submission

042453-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4840 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121838541-121889057 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121885854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1387 (M1387K)

Ref Sequence

ENSEMBL: ENSMUSP00000032228 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032228]

AlphaFold

P28665

Predicted Effect

probably damaging
Transcript: ENSMUST00000032228
AA Change: M1387K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: M1387K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:A2M_N	128	221	5e-21	PFAM
A2M_N_2	449	599	2.55e-41	SMART
A2M	740	830	5.43e-36	SMART
Pfam:Thiol-ester_cl	963	992	1e-18	PFAM
Pfam:A2M_comp	1012	1268	5.4e-94	PFAM
A2M_recep	1378	1465	4.14e-41	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148563

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204210

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

97% (114/117)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810459M11Rik	C	A	1: 86,046,444	T161K	probably benign	Het
Actn3	G	A	19: 4,864,511	R530W	probably damaging	Het
Alg11	C	T	8: 22,068,010	A404V	possibly damaging	Het
Alkbh8	T	A	9: 3,369,751	V340D	probably damaging	Het
Arhgef12	T	C	9: 42,975,068	H1166R	probably benign	Het
Aspm	T	A	1: 139,470,531	D978E	possibly damaging	Het
Bod1l	C	T	5: 41,818,472	G1833D	probably damaging	Het
Brd3	A	G	2: 27,449,239	V676A	possibly damaging	Het
Brip1	G	A	11: 86,146,183	T454I	possibly damaging	Het
C3ar1	T	C	6: 122,850,764	I165V	probably benign	Het
C87977	T	C	4: 144,208,574	K199R	probably damaging	Het
Camta1	T	A	4: 151,144,407	Q656L	probably benign	Het
Casp14	A	T	10: 78,713,344	L256*	probably null	Het
Cdh23	G	T	10: 60,419,777	H773Q	possibly damaging	Het
Chd1	G	A	17: 15,768,753	W1589*	probably null	Het
Chd1	G	T	17: 15,768,754	D1590Y	probably damaging	Het
Cldn19	A	G	4: 119,255,754	Q61R	probably damaging	Het
Cyp2a22	A	G	7: 26,932,524	S436P	probably benign	Het
E130218I03Rik	A	G	4: 134,245,276		probably benign	Het
Emc10	A	C	7: 44,492,627	V124G	probably damaging	Het
Enam	A	T	5: 88,503,026	D723V	probably benign	Het
Eps8	C	A	6: 137,527,130	Q158H	probably damaging	Het
Ercc6	G	A	14: 32,541,296	D486N	probably damaging	Het
Fasn	T	C	11: 120,813,059	E1485G	possibly damaging	Het
Fat2	T	C	11: 55,279,018	K2972E	probably benign	Het
Fbxw28	T	C	9: 109,339,534	K30R	probably null	Het
Flot2	T	A	11: 78,057,513	L164Q	probably damaging	Het
Fsip2	A	T	2: 82,949,395	I162L	probably benign	Het
Fsip2	A	T	2: 82,985,471	L3849F	probably benign	Het
Gabrb1	C	G	5: 71,700,811	P60R	probably damaging	Het
Galnt14	T	C	17: 73,504,898	R443G	probably benign	Het
Gas8	C	T	8: 123,531,014	T400M	probably benign	Het
Gfap	T	C	11: 102,894,388	Y254C	probably damaging	Het
Git2	A	G	5: 114,745,482	S396P	probably damaging	Het
Glb1l3	A	T	9: 26,829,053	M327K	probably benign	Het
Gm10715	A	C	9: 3,038,062		probably benign	Het
Gm10787	G	A	10: 77,022,007		noncoding transcript	Het
Gm1123	T	A	9: 99,018,569	D78V	probably damaging	Het
Gm27013	T	C	6: 130,678,116	T128A	probably benign	Het
Gm8979	T	C	7: 106,081,420		noncoding transcript	Het
Gpbp1	A	G	13: 111,440,630		probably null	Het
Gphn	G	A	12: 78,522,955		probably null	Het
Gpr157	A	G	4: 150,102,366	E317G	probably benign	Het
Gsdmc4	T	A	15: 63,893,747	M318L	probably benign	Het
Gtf2f2	A	T	14: 76,010,691	W19R	probably damaging	Het
Helb	A	G	10: 120,084,858	V1060A	probably benign	Het
Igfn1	C	T	1: 135,968,040	G1596D	probably benign	Het
Il1rl2	T	C	1: 40,327,387	I27T	possibly damaging	Het
Inpp5j	A	G	11: 3,499,676	V702A	probably damaging	Het
Kmt2d	A	C	15: 98,861,894	V1161G	unknown	Het
Krtap1-3	T	G	11: 99,590,889	Y144S	possibly damaging	Het
Layn	C	T	9: 51,057,382	V354M	probably damaging	Het
Lrba	G	A	3: 86,619,509		probably null	Het
Lrp8	T	A	4: 107,870,037	L893Q	possibly damaging	Het
Mrps9	T	A	1: 42,898,415		probably benign	Het
Myo18b	A	C	5: 112,874,029	V499G	probably benign	Het
Nbea	T	C	3: 55,710,670	E2321G	probably benign	Het
Nrsn2	C	T	2: 152,369,632	V160I	probably benign	Het
Nup210	G	A	6: 91,031,668	Q510*	probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr693	T	G	7: 106,678,123	D121A	probably damaging	Het
P3h3	G	T	6: 124,850,637	Q479K	possibly damaging	Het
Paqr9	T	A	9: 95,560,670	F238I	probably damaging	Het
Parp3	A	T	9: 106,473,109	L343H	probably damaging	Het
Pcdh18	A	C	3: 49,744,668	M1115R	probably damaging	Het
Pcdh8	A	G	14: 79,770,868	V85A	possibly damaging	Het
Pcdhb4	A	G	18: 37,308,399	N254S	possibly damaging	Het
Pld1	T	C	3: 28,076,551	V500A	probably benign	Het
Prkg2	A	T	5: 98,981,143	D311E	probably benign	Het
Prss42	T	C	9: 110,799,301	L171P	probably damaging	Het
Pth2	T	A	7: 45,181,343	L17H	probably damaging	Het
Reln	A	T	5: 22,018,846		probably null	Het
Rmi2	G	T	16: 10,839,837	V104L	probably damaging	Het
Rpusd4	T	A	9: 35,268,535	V108D	probably damaging	Het
Rufy4	C	A	1: 74,129,039	T82K	possibly damaging	Het
Scimp	G	A	11: 70,791,468	Q141*	probably null	Het
Sel1l2	T	C	2: 140,263,470	T267A	probably benign	Het
Sema5a	T	A	15: 32,550,254	S146R	possibly damaging	Het
Sh2d3c	T	C	2: 32,721,160	M1T	probably null	Het
Slc30a6	T	C	17: 74,405,721	L71P	probably damaging	Het
Srrm3	A	G	5: 135,854,595	Y224C	possibly damaging	Het
Tacr3	A	T	3: 134,854,854	T185S	possibly damaging	Het
Tas2r140	T	A	6: 133,055,565	T77S	probably benign	Het
Thsd7b	T	C	1: 129,595,844	V128A	probably benign	Het
Tnfrsf10b	T	G	14: 69,776,159	H179Q	probably damaging	Het
Tonsl	A	G	15: 76,633,209	V770A	probably benign	Het
Trim42	G	A	9: 97,362,929	P606L	probably benign	Het
Trim45	A	T	3: 100,925,488	T346S	possibly damaging	Het
Ttc28	C	A	5: 111,286,081	S2296Y	probably damaging	Het
Ttc41	C	T	10: 86,731,125	R552C	probably benign	Het
Tube1	A	G	10: 39,144,846	N243D	probably benign	Het
Tvp23b	G	T	11: 62,879,598		probably null	Het
Ubxn11	T	A	4: 134,109,608	I49N	probably damaging	Het
Usp17le	T	A	7: 104,769,770	E55V	probably benign	Het
Vmn2r114	A	T	17: 23,291,379	V709D	probably damaging	Het
Vmn2r23	C	T	6: 123,713,074	T303M	probably damaging	Het
Vmn2r60	C	T	7: 42,135,861	P166S	probably damaging	Het
Vmn2r83	A	G	10: 79,477,848	I97V	possibly damaging	Het
Vmn2r-ps159	G	C	4: 156,333,438		noncoding transcript	Het
Wbp2nl	A	T	15: 82,314,336	K358M	possibly damaging	Het
Xpo1	T	A	11: 23,278,183	I150N	probably damaging	Het
Zfp113	G	A	5: 138,145,425	L188F	probably damaging	Het
Zfp189	T	G	4: 49,529,984	S362R	probably damaging	Het

Other mutations in Mug1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Mug1	APN	6	121865809	missense	probably damaging	1.00
IGL00485:Mug1	APN	6	121887416	missense	probably benign	0.17
IGL00816:Mug1	APN	6	121882638	missense	probably damaging	0.99
IGL01140:Mug1	APN	6	121882734	missense	probably benign	0.01
IGL01141:Mug1	APN	6	121870499	missense	probably benign	0.08
IGL01384:Mug1	APN	6	121849474	splice site	probably benign
IGL01659:Mug1	APN	6	121870660	splice site	probably benign
IGL02049:Mug1	APN	6	121871336	missense	probably benign
IGL02151:Mug1	APN	6	121884690	critical splice donor site	probably null
IGL02315:Mug1	APN	6	121840167	missense	probably benign
IGL02629:Mug1	APN	6	121840065	missense	possibly damaging	0.62
IGL02642:Mug1	APN	6	121882585	missense	probably benign	0.14
IGL02807:Mug1	APN	6	121886572	missense	probably damaging	0.96
IGL02932:Mug1	APN	6	121887427	missense	probably benign	0.35
IGL03232:Mug1	APN	6	121878535	missense	probably benign	0.00
R1462_Mug1_304	UTSW	6	121882629	missense	probably benign	0.41
R2341_Mug1_749	UTSW	6	121884629	missense	probably benign	0.06
R4261_Mug1_652	UTSW	6	121873734	missense	probably benign
R6173_mug1_139	UTSW	6	121863793	missense	probably damaging	0.99
IGL03050:Mug1	UTSW	6	121880571	missense	possibly damaging	0.90
R0101:Mug1	UTSW	6	121884247	missense	possibly damaging	0.59
R0194:Mug1	UTSW	6	121840107	missense	probably damaging	0.98
R0196:Mug1	UTSW	6	121838725	critical splice donor site	probably null
R0325:Mug1	UTSW	6	121849842	missense	probably benign
R0332:Mug1	UTSW	6	121849897	splice site	probably null
R0377:Mug1	UTSW	6	121857361	missense	probably benign	0.02
R0393:Mug1	UTSW	6	121849850	missense	possibly damaging	0.64
R0414:Mug1	UTSW	6	121856554	missense	probably benign	0.00
R0457:Mug1	UTSW	6	121861555	missense	probably benign	0.06
R0479:Mug1	UTSW	6	121840227	missense	probably benign
R0519:Mug1	UTSW	6	121851424	missense	possibly damaging	0.83
R0535:Mug1	UTSW	6	121851454	missense	probably benign
R0745:Mug1	UTSW	6	121887427	missense	probably benign	0.35
R0939:Mug1	UTSW	6	121884349	missense	possibly damaging	0.95
R0975:Mug1	UTSW	6	121878539	missense	probably damaging	0.99
R1033:Mug1	UTSW	6	121880551	missense	probably damaging	0.99
R1086:Mug1	UTSW	6	121885854	missense	probably damaging	1.00
R1116:Mug1	UTSW	6	121870645	missense	probably benign
R1131:Mug1	UTSW	6	121861185	missense	probably benign	0.18
R1249:Mug1	UTSW	6	121849461	missense	probably benign	0.07
R1364:Mug1	UTSW	6	121881713	missense	probably damaging	1.00
R1418:Mug1	UTSW	6	121838676	missense	probably benign	0.00
R1462:Mug1	UTSW	6	121882629	missense	probably benign	0.41
R1462:Mug1	UTSW	6	121882629	missense	probably benign	0.41
R1494:Mug1	UTSW	6	121879300	missense	probably damaging	1.00
R1639:Mug1	UTSW	6	121880571	missense	probably damaging	1.00
R1901:Mug1	UTSW	6	121881821	missense	probably benign
R1902:Mug1	UTSW	6	121881821	missense	probably benign
R2087:Mug1	UTSW	6	121856291	missense	probably benign	0.00
R2168:Mug1	UTSW	6	121870499	missense	probably benign	0.08
R2249:Mug1	UTSW	6	121870510	missense	probably benign
R2341:Mug1	UTSW	6	121884629	missense	probably benign	0.06
R2888:Mug1	UTSW	6	121881843	missense	probably benign	0.44
R2892:Mug1	UTSW	6	121840070	missense	possibly damaging	0.91
R3703:Mug1	UTSW	6	121888556	splice site	probably benign
R3789:Mug1	UTSW	6	121884628	missense	probably benign	0.03
R3790:Mug1	UTSW	6	121884628	missense	probably benign	0.03
R3950:Mug1	UTSW	6	121878530	missense	probably damaging	1.00
R4261:Mug1	UTSW	6	121873734	missense	probably benign
R4402:Mug1	UTSW	6	121879352	missense	probably damaging	1.00
R4589:Mug1	UTSW	6	121857351	missense	probably benign	0.19
R4707:Mug1	UTSW	6	121884641	missense	probably damaging	1.00
R4766:Mug1	UTSW	6	121884254	missense	probably benign	0.01
R4984:Mug1	UTSW	6	121838617	utr 5 prime	probably benign
R4999:Mug1	UTSW	6	121878943	nonsense	probably null
R5198:Mug1	UTSW	6	121874562	missense	probably damaging	1.00
R5220:Mug1	UTSW	6	121861133	missense	probably benign	0.03
R5253:Mug1	UTSW	6	121888913	missense	probably benign	0.03
R5273:Mug1	UTSW	6	121873789	missense	probably damaging	0.99
R5285:Mug1	UTSW	6	121841107	missense	probably benign	0.45
R5387:Mug1	UTSW	6	121884394	missense	probably damaging	0.99
R5560:Mug1	UTSW	6	121861073	missense	probably damaging	0.96
R5652:Mug1	UTSW	6	121840181	missense	probably benign
R5704:Mug1	UTSW	6	121851433	missense	possibly damaging	0.63
R5732:Mug1	UTSW	6	121878493	missense	probably benign	0.00
R6053:Mug1	UTSW	6	121865738	missense	probably benign	0.00
R6173:Mug1	UTSW	6	121863793	missense	probably damaging	0.99
R6578:Mug1	UTSW	6	121887452	missense	probably benign	0.00
R6647:Mug1	UTSW	6	121840241	missense	probably benign	0.02
R6681:Mug1	UTSW	6	121838724	missense	possibly damaging	0.75
R6925:Mug1	UTSW	6	121881787	missense	probably damaging	1.00
R7014:Mug1	UTSW	6	121861125	missense	probably benign	0.22
R7031:Mug1	UTSW	6	121838714	missense	probably benign	0.00
R7034:Mug1	UTSW	6	121873644	missense	probably benign	0.00
R7156:Mug1	UTSW	6	121880905	missense	probably damaging	1.00
R7156:Mug1	UTSW	6	121884343	missense	probably damaging	1.00
R7179:Mug1	UTSW	6	121857420	missense	probably benign	0.00
R7211:Mug1	UTSW	6	121880539	missense	possibly damaging	0.52
R7318:Mug1	UTSW	6	121870652	critical splice donor site	probably null
R7462:Mug1	UTSW	6	121875440	missense	probably benign	0.00
R7479:Mug1	UTSW	6	121878508	missense	possibly damaging	0.83
R7588:Mug1	UTSW	6	121875517	missense	probably damaging	1.00
R7611:Mug1	UTSW	6	121875428	critical splice acceptor site	probably null
R7659:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7660:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7661:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7663:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7664:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7666:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7788:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7789:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7794:Mug1	UTSW	6	121856288	missense	possibly damaging	0.93
R7809:Mug1	UTSW	6	121878985	missense	possibly damaging	0.79
R7836:Mug1	UTSW	6	121870652	critical splice donor site	probably null
R7867:Mug1	UTSW	6	121873634	missense	probably benign
R7904:Mug1	UTSW	6	121851465	missense	probably benign
R7937:Mug1	UTSW	6	121861169	missense	probably benign	0.00
R7981:Mug1	UTSW	6	121881764	missense	probably damaging	1.00
R7999:Mug1	UTSW	6	121880896	missense	possibly damaging	0.90
R8070:Mug1	UTSW	6	121875879	missense	probably benign	0.26
R8071:Mug1	UTSW	6	121873672	missense	probably benign
R8151:Mug1	UTSW	6	121841158	missense	probably benign	0.01
R8491:Mug1	UTSW	6	121882729	missense	probably damaging	1.00
R8714:Mug1	UTSW	6	121882722	missense	probably benign	0.01
R8734:Mug1	UTSW	6	121871381	missense	probably benign	0.00
R8738:Mug1	UTSW	6	121840249	splice site	probably benign
R8807:Mug1	UTSW	6	121874475	missense	probably benign	0.27
R8931:Mug1	UTSW	6	121884337	missense	probably benign
R8940:Mug1	UTSW	6	121881683	missense
R9156:Mug1	UTSW	6	121874431	missense	probably damaging	0.99
R9314:Mug1	UTSW	6	121857337	missense	probably damaging	0.97
R9315:Mug1	UTSW	6	121873771	missense	possibly damaging	0.95
R9330:Mug1	UTSW	6	121882764	missense	probably benign	0.14
R9334:Mug1	UTSW	6	121861531	missense	probably benign	0.01
R9357:Mug1	UTSW	6	121875491	missense	probably benign	0.02
R9515:Mug1	UTSW	6	121884676	missense	probably damaging	1.00
R9549:Mug1	UTSW	6	121881803	missense	probably damaging	1.00
R9564:Mug1	UTSW	6	121884628	missense	probably benign	0.03
R9663:Mug1	UTSW	6	121880504	missense	probably benign	0.08
R9663:Mug1	UTSW	6	121882740	missense	probably benign	0.03
R9681:Mug1	UTSW	6	121856295	missense	probably benign	0.01
R9777:Mug1	UTSW	6	121880905	missense	probably damaging	1.00
RF017:Mug1	UTSW	6	121884574	missense	probably damaging	1.00
X0064:Mug1	UTSW	6	121861215	missense	possibly damaging	0.48
Z1176:Mug1	UTSW	6	121841294	missense	probably benign	0.32
Z1176:Mug1	UTSW	6	121880493	missense	probably damaging	1.00
Z1177:Mug1	UTSW	6	121863808	missense	probably damaging	0.99
Z1177:Mug1	UTSW	6	121879299	critical splice acceptor site	probably null
Z1177:Mug1	UTSW	6	121886568	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCACAGCCATTTTAATGCACTC -3'
(R):5'- CAGCATTTTAACACCATCCAAGTG -3'

Sequencing Primer
(F):5'- GCACTCTCCAGATGATATTGTTATGC -3'
(R):5'- CCATCCAAGTGTGTTAAATTAATGC -3'

Posted On

2016-03-01