Incidental Mutation 'R4840:C3ar1'
ID371722
Institutional Source Beutler Lab
Gene Symbol C3ar1
Ensembl Gene ENSMUSG00000040552
Gene Namecomplement component 3a receptor 1
SynonymsC3aR, anaphylatoxin C3a receptor
MMRRC Submission 042453-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4840 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122847138-122856161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122850764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 165 (I165V)
Ref Sequence ENSEMBL: ENSMUSP00000048092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042081]
Predicted Effect probably benign
Transcript: ENSMUST00000042081
AA Change: I165V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: I165V

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 97% (114/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C A 1: 86,046,444 T161K probably benign Het
Actn3 G A 19: 4,864,511 R530W probably damaging Het
Alg11 C T 8: 22,068,010 A404V possibly damaging Het
Alkbh8 T A 9: 3,369,751 V340D probably damaging Het
Arhgef12 T C 9: 42,975,068 H1166R probably benign Het
Aspm T A 1: 139,470,531 D978E possibly damaging Het
Bod1l C T 5: 41,818,472 G1833D probably damaging Het
Brd3 A G 2: 27,449,239 V676A possibly damaging Het
Brip1 G A 11: 86,146,183 T454I possibly damaging Het
C87977 T C 4: 144,208,574 K199R probably damaging Het
Camta1 T A 4: 151,144,407 Q656L probably benign Het
Casp14 A T 10: 78,713,344 L256* probably null Het
Cdh23 G T 10: 60,419,777 H773Q possibly damaging Het
Chd1 G A 17: 15,768,753 W1589* probably null Het
Chd1 G T 17: 15,768,754 D1590Y probably damaging Het
Cldn19 A G 4: 119,255,754 Q61R probably damaging Het
Cyp2a22 A G 7: 26,932,524 S436P probably benign Het
E130218I03Rik A G 4: 134,245,276 probably benign Het
Emc10 A C 7: 44,492,627 V124G probably damaging Het
Enam A T 5: 88,503,026 D723V probably benign Het
Eps8 C A 6: 137,527,130 Q158H probably damaging Het
Ercc6 G A 14: 32,541,296 D486N probably damaging Het
Fasn T C 11: 120,813,059 E1485G possibly damaging Het
Fat2 T C 11: 55,279,018 K2972E probably benign Het
Fbxw28 T C 9: 109,339,534 K30R probably null Het
Flot2 T A 11: 78,057,513 L164Q probably damaging Het
Fsip2 A T 2: 82,949,395 I162L probably benign Het
Fsip2 A T 2: 82,985,471 L3849F probably benign Het
Gabrb1 C G 5: 71,700,811 P60R probably damaging Het
Galnt14 T C 17: 73,504,898 R443G probably benign Het
Gas8 C T 8: 123,531,014 T400M probably benign Het
Gfap T C 11: 102,894,388 Y254C probably damaging Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
Glb1l3 A T 9: 26,829,053 M327K probably benign Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10787 G A 10: 77,022,007 noncoding transcript Het
Gm1123 T A 9: 99,018,569 D78V probably damaging Het
Gm27013 T C 6: 130,678,116 T128A probably benign Het
Gm8979 T C 7: 106,081,420 noncoding transcript Het
Gpbp1 A G 13: 111,440,630 probably null Het
Gphn G A 12: 78,522,955 probably null Het
Gpr157 A G 4: 150,102,366 E317G probably benign Het
Gsdmc4 T A 15: 63,893,747 M318L probably benign Het
Gtf2f2 A T 14: 76,010,691 W19R probably damaging Het
Helb A G 10: 120,084,858 V1060A probably benign Het
Igfn1 C T 1: 135,968,040 G1596D probably benign Het
Il1rl2 T C 1: 40,327,387 I27T possibly damaging Het
Inpp5j A G 11: 3,499,676 V702A probably damaging Het
Kmt2d A C 15: 98,861,894 V1161G unknown Het
Krtap1-3 T G 11: 99,590,889 Y144S possibly damaging Het
Layn C T 9: 51,057,382 V354M probably damaging Het
Lrba G A 3: 86,619,509 probably null Het
Lrp8 T A 4: 107,870,037 L893Q possibly damaging Het
Mrps9 T A 1: 42,898,415 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Myo18b A C 5: 112,874,029 V499G probably benign Het
Nbea T C 3: 55,710,670 E2321G probably benign Het
Nrsn2 C T 2: 152,369,632 V160I probably benign Het
Nup210 G A 6: 91,031,668 Q510* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr693 T G 7: 106,678,123 D121A probably damaging Het
P3h3 G T 6: 124,850,637 Q479K possibly damaging Het
Paqr9 T A 9: 95,560,670 F238I probably damaging Het
Parp3 A T 9: 106,473,109 L343H probably damaging Het
Pcdh18 A C 3: 49,744,668 M1115R probably damaging Het
Pcdh8 A G 14: 79,770,868 V85A possibly damaging Het
Pcdhb4 A G 18: 37,308,399 N254S possibly damaging Het
Pld1 T C 3: 28,076,551 V500A probably benign Het
Prkg2 A T 5: 98,981,143 D311E probably benign Het
Prss42 T C 9: 110,799,301 L171P probably damaging Het
Pth2 T A 7: 45,181,343 L17H probably damaging Het
Reln A T 5: 22,018,846 probably null Het
Rmi2 G T 16: 10,839,837 V104L probably damaging Het
Rpusd4 T A 9: 35,268,535 V108D probably damaging Het
Rufy4 C A 1: 74,129,039 T82K possibly damaging Het
Scimp G A 11: 70,791,468 Q141* probably null Het
Sel1l2 T C 2: 140,263,470 T267A probably benign Het
Sema5a T A 15: 32,550,254 S146R possibly damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Slc30a6 T C 17: 74,405,721 L71P probably damaging Het
Srrm3 A G 5: 135,854,595 Y224C possibly damaging Het
Tacr3 A T 3: 134,854,854 T185S possibly damaging Het
Tas2r140 T A 6: 133,055,565 T77S probably benign Het
Thsd7b T C 1: 129,595,844 V128A probably benign Het
Tnfrsf10b T G 14: 69,776,159 H179Q probably damaging Het
Tonsl A G 15: 76,633,209 V770A probably benign Het
Trim42 G A 9: 97,362,929 P606L probably benign Het
Trim45 A T 3: 100,925,488 T346S possibly damaging Het
Ttc28 C A 5: 111,286,081 S2296Y probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Tube1 A G 10: 39,144,846 N243D probably benign Het
Tvp23b G T 11: 62,879,598 probably null Het
Ubxn11 T A 4: 134,109,608 I49N probably damaging Het
Usp17le T A 7: 104,769,770 E55V probably benign Het
Vmn2r114 A T 17: 23,291,379 V709D probably damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r60 C T 7: 42,135,861 P166S probably damaging Het
Vmn2r83 A G 10: 79,477,848 I97V possibly damaging Het
Vmn2r-ps159 G C 4: 156,333,438 noncoding transcript Het
Wbp2nl A T 15: 82,314,336 K358M possibly damaging Het
Xpo1 T A 11: 23,278,183 I150N probably damaging Het
Zfp113 G A 5: 138,145,425 L188F probably damaging Het
Zfp189 T G 4: 49,529,984 S362R probably damaging Het
Other mutations in C3ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:C3ar1 APN 6 122850419 missense probably benign 0.00
IGL01936:C3ar1 APN 6 122851235 missense probably benign 0.04
IGL01998:C3ar1 APN 6 122850940 missense probably damaging 1.00
IGL02351:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02358:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02399:C3ar1 APN 6 122849879 missense probably benign 0.00
PIT4618001:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0014:C3ar1 UTSW 6 122850851 missense probably damaging 1.00
R0195:C3ar1 UTSW 6 122851155 missense possibly damaging 0.95
R0257:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0344:C3ar1 UTSW 6 122850772 missense probably benign 0.45
R4345:C3ar1 UTSW 6 122850700 missense probably damaging 1.00
R4614:C3ar1 UTSW 6 122850721 missense probably benign 0.00
R4643:C3ar1 UTSW 6 122850974 missense probably damaging 1.00
R5235:C3ar1 UTSW 6 122850922 missense probably damaging 1.00
R5303:C3ar1 UTSW 6 122849835 missense probably damaging 1.00
R5610:C3ar1 UTSW 6 122850578 missense probably benign 0.01
R5762:C3ar1 UTSW 6 122850362 missense probably benign 0.07
R5873:C3ar1 UTSW 6 122850422 missense probably benign 0.24
R5877:C3ar1 UTSW 6 122850622 missense probably benign 0.17
R6327:C3ar1 UTSW 6 122850146 missense probably damaging 1.00
R6440:C3ar1 UTSW 6 122850508 missense probably damaging 0.99
R6505:C3ar1 UTSW 6 122850640 missense probably benign 0.03
R6636:C3ar1 UTSW 6 122851054 missense probably damaging 1.00
R6755:C3ar1 UTSW 6 122849858 missense probably benign 0.00
R6953:C3ar1 UTSW 6 122850632 missense possibly damaging 0.49
R8049:C3ar1 UTSW 6 122850100 missense probably damaging 0.97
X0065:C3ar1 UTSW 6 122850765 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCCCTTGCCTGTACAGAGG -3'
(R):5'- TATGGCTTGTTCCTGTGCAAAC -3'

Sequencing Primer
(F):5'- GAAGGAGCTGACCTGTCATTC -3'
(R):5'- ATTCTCAACATGTTTGCCAGTG -3'
Posted On2016-03-01