Incidental Mutation 'R4840:Usp17le'
ID371732
Institutional Source Beutler Lab
Gene Symbol Usp17le
Ensembl Gene ENSMUSG00000043073
Gene Nameubiquitin specific peptidase 17-like E
SynonymsGm6596, Dub3
MMRRC Submission 042453-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4840 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104768049-104777470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104769770 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 55 (E55V)
Ref Sequence ENSEMBL: ENSMUSP00000147776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053464] [ENSMUST00000211384]
Predicted Effect probably benign
Transcript: ENSMUST00000053464
AA Change: E55V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051716
Gene: ENSMUSG00000043073
AA Change: E55V

DomainStartEndE-ValueType
Pfam:UCH 84 379 9e-54 PFAM
Pfam:UCH_1 85 362 2.3e-21 PFAM
low complexity region 408 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211384
AA Change: E55V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 97% (114/117)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C A 1: 86,046,444 T161K probably benign Het
Actn3 G A 19: 4,864,511 R530W probably damaging Het
Alg11 C T 8: 22,068,010 A404V possibly damaging Het
Alkbh8 T A 9: 3,369,751 V340D probably damaging Het
Arhgef12 T C 9: 42,975,068 H1166R probably benign Het
Aspm T A 1: 139,470,531 D978E possibly damaging Het
Bod1l C T 5: 41,818,472 G1833D probably damaging Het
Brd3 A G 2: 27,449,239 V676A possibly damaging Het
Brip1 G A 11: 86,146,183 T454I possibly damaging Het
C3ar1 T C 6: 122,850,764 I165V probably benign Het
C87977 T C 4: 144,208,574 K199R probably damaging Het
Camta1 T A 4: 151,144,407 Q656L probably benign Het
Casp14 A T 10: 78,713,344 L256* probably null Het
Cdh23 G T 10: 60,419,777 H773Q possibly damaging Het
Chd1 G A 17: 15,768,753 W1589* probably null Het
Chd1 G T 17: 15,768,754 D1590Y probably damaging Het
Cldn19 A G 4: 119,255,754 Q61R probably damaging Het
Cyp2a22 A G 7: 26,932,524 S436P probably benign Het
E130218I03Rik A G 4: 134,245,276 probably benign Het
Emc10 A C 7: 44,492,627 V124G probably damaging Het
Enam A T 5: 88,503,026 D723V probably benign Het
Eps8 C A 6: 137,527,130 Q158H probably damaging Het
Ercc6 G A 14: 32,541,296 D486N probably damaging Het
Fasn T C 11: 120,813,059 E1485G possibly damaging Het
Fat2 T C 11: 55,279,018 K2972E probably benign Het
Fbxw28 T C 9: 109,339,534 K30R probably null Het
Flot2 T A 11: 78,057,513 L164Q probably damaging Het
Fsip2 A T 2: 82,949,395 I162L probably benign Het
Fsip2 A T 2: 82,985,471 L3849F probably benign Het
Gabrb1 C G 5: 71,700,811 P60R probably damaging Het
Galnt14 T C 17: 73,504,898 R443G probably benign Het
Gas8 C T 8: 123,531,014 T400M probably benign Het
Gfap T C 11: 102,894,388 Y254C probably damaging Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
Glb1l3 A T 9: 26,829,053 M327K probably benign Het
Gm10715 A C 9: 3,038,062 probably benign Het
Gm10787 G A 10: 77,022,007 noncoding transcript Het
Gm1123 T A 9: 99,018,569 D78V probably damaging Het
Gm27013 T C 6: 130,678,116 T128A probably benign Het
Gm8979 T C 7: 106,081,420 noncoding transcript Het
Gpbp1 A G 13: 111,440,630 probably null Het
Gphn G A 12: 78,522,955 probably null Het
Gpr157 A G 4: 150,102,366 E317G probably benign Het
Gsdmc4 T A 15: 63,893,747 M318L probably benign Het
Gtf2f2 A T 14: 76,010,691 W19R probably damaging Het
Helb A G 10: 120,084,858 V1060A probably benign Het
Igfn1 C T 1: 135,968,040 G1596D probably benign Het
Il1rl2 T C 1: 40,327,387 I27T possibly damaging Het
Inpp5j A G 11: 3,499,676 V702A probably damaging Het
Kmt2d A C 15: 98,861,894 V1161G unknown Het
Krtap1-3 T G 11: 99,590,889 Y144S possibly damaging Het
Layn C T 9: 51,057,382 V354M probably damaging Het
Lrba G A 3: 86,619,509 probably null Het
Lrp8 T A 4: 107,870,037 L893Q possibly damaging Het
Mrps9 T A 1: 42,898,415 probably benign Het
Mug1 T A 6: 121,885,854 M1387K probably damaging Het
Myo18b A C 5: 112,874,029 V499G probably benign Het
Nbea T C 3: 55,710,670 E2321G probably benign Het
Nrsn2 C T 2: 152,369,632 V160I probably benign Het
Nup210 G A 6: 91,031,668 Q510* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr693 T G 7: 106,678,123 D121A probably damaging Het
P3h3 G T 6: 124,850,637 Q479K possibly damaging Het
Paqr9 T A 9: 95,560,670 F238I probably damaging Het
Parp3 A T 9: 106,473,109 L343H probably damaging Het
Pcdh18 A C 3: 49,744,668 M1115R probably damaging Het
Pcdh8 A G 14: 79,770,868 V85A possibly damaging Het
Pcdhb4 A G 18: 37,308,399 N254S possibly damaging Het
Pld1 T C 3: 28,076,551 V500A probably benign Het
Prkg2 A T 5: 98,981,143 D311E probably benign Het
Prss42 T C 9: 110,799,301 L171P probably damaging Het
Pth2 T A 7: 45,181,343 L17H probably damaging Het
Reln A T 5: 22,018,846 probably null Het
Rmi2 G T 16: 10,839,837 V104L probably damaging Het
Rpusd4 T A 9: 35,268,535 V108D probably damaging Het
Rufy4 C A 1: 74,129,039 T82K possibly damaging Het
Scimp G A 11: 70,791,468 Q141* probably null Het
Sel1l2 T C 2: 140,263,470 T267A probably benign Het
Sema5a T A 15: 32,550,254 S146R possibly damaging Het
Sh2d3c T C 2: 32,721,160 M1T probably null Het
Slc30a6 T C 17: 74,405,721 L71P probably damaging Het
Srrm3 A G 5: 135,854,595 Y224C possibly damaging Het
Tacr3 A T 3: 134,854,854 T185S possibly damaging Het
Tas2r140 T A 6: 133,055,565 T77S probably benign Het
Thsd7b T C 1: 129,595,844 V128A probably benign Het
Tnfrsf10b T G 14: 69,776,159 H179Q probably damaging Het
Tonsl A G 15: 76,633,209 V770A probably benign Het
Trim42 G A 9: 97,362,929 P606L probably benign Het
Trim45 A T 3: 100,925,488 T346S possibly damaging Het
Ttc28 C A 5: 111,286,081 S2296Y probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Tube1 A G 10: 39,144,846 N243D probably benign Het
Tvp23b G T 11: 62,879,598 probably null Het
Ubxn11 T A 4: 134,109,608 I49N probably damaging Het
Vmn2r114 A T 17: 23,291,379 V709D probably damaging Het
Vmn2r23 C T 6: 123,713,074 T303M probably damaging Het
Vmn2r60 C T 7: 42,135,861 P166S probably damaging Het
Vmn2r83 A G 10: 79,477,848 I97V possibly damaging Het
Vmn2r-ps159 G C 4: 156,333,438 noncoding transcript Het
Wbp2nl A T 15: 82,314,336 K358M possibly damaging Het
Xpo1 T A 11: 23,278,183 I150N probably damaging Het
Zfp113 G A 5: 138,145,425 L188F probably damaging Het
Zfp189 T G 4: 49,529,984 S362R probably damaging Het
Other mutations in Usp17le
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Usp17le APN 7 104768787 missense probably benign 0.00
IGL01974:Usp17le APN 7 104768435 missense probably benign
IGL02364:Usp17le APN 7 104768775 nonsense probably null
IGL02413:Usp17le APN 7 104769726 missense probably benign 0.39
IGL02433:Usp17le APN 7 104769201 missense probably benign 0.01
IGL02960:Usp17le APN 7 104768740 missense probably benign
IGL02984:Usp17le UTSW 7 104769104 missense probably benign 0.21
R0035:Usp17le UTSW 7 104769062 nonsense probably null
R0389:Usp17le UTSW 7 104768460 missense probably damaging 0.96
R0499:Usp17le UTSW 7 104768501 missense probably benign 0.02
R0567:Usp17le UTSW 7 104768898 missense possibly damaging 0.95
R0879:Usp17le UTSW 7 104769647 missense probably damaging 0.99
R0879:Usp17le UTSW 7 104769648 missense possibly damaging 0.46
R5140:Usp17le UTSW 7 104769438 missense probably damaging 1.00
R5403:Usp17le UTSW 7 104769234 missense probably damaging 1.00
R6210:Usp17le UTSW 7 104769143 missense probably damaging 1.00
R7047:Usp17le UTSW 7 104768433 missense probably benign 0.02
R7157:Usp17le UTSW 7 104768489 missense probably benign 0.03
R7361:Usp17le UTSW 7 104768877 missense probably damaging 1.00
R7386:Usp17le UTSW 7 104768307 splice site probably null
R7997:Usp17le UTSW 7 104768839 missense possibly damaging 0.94
R8189:Usp17le UTSW 7 104769348 missense probably damaging 0.99
R8248:Usp17le UTSW 7 104769794 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTCAGCTAGAGGTGGTGTG -3'
(R):5'- AAGGCCTTTTGCAGCTTGC -3'

Sequencing Primer
(F):5'- AGAGGTGGTGTGTGTGTCAAGC -3'
(R):5'- GAGCCCTGATTATCTCTCAGTGTAAG -3'
Posted On2016-03-01