Incidental Mutation 'R4840:Ttc41'
ID 371755
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms BC030307, Gnn
MMRRC Submission 042453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R4840 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86541675-86612708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86566989 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 552 (R552C)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070435
SMART Domains Protein: ENSMUSP00000136633
Gene: ENSMUSG00000056366

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 6.5e-13 PFAM
Pfam:Lipocalin 6 132 2.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: R552C

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: R552C

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: R552C

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 97% (114/117)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C A 1: 85,974,166 (GRCm39) T161K probably benign Het
Actn3 G A 19: 4,914,539 (GRCm39) R530W probably damaging Het
Alg11 C T 8: 22,558,026 (GRCm39) A404V possibly damaging Het
Alkbh8 T A 9: 3,369,751 (GRCm39) V340D probably damaging Het
Arhgef12 T C 9: 42,886,364 (GRCm39) H1166R probably benign Het
Aspm T A 1: 139,398,269 (GRCm39) D978E possibly damaging Het
Bod1l C T 5: 41,975,815 (GRCm39) G1833D probably damaging Het
Brd3 A G 2: 27,339,251 (GRCm39) V676A possibly damaging Het
Brip1 G A 11: 86,037,009 (GRCm39) T454I possibly damaging Het
C3ar1 T C 6: 122,827,723 (GRCm39) I165V probably benign Het
Camta1 T A 4: 151,228,864 (GRCm39) Q656L probably benign Het
Casp14 A T 10: 78,549,178 (GRCm39) L256* probably null Het
Cdh23 G T 10: 60,255,556 (GRCm39) H773Q possibly damaging Het
Chd1 G T 17: 15,989,016 (GRCm39) D1590Y probably damaging Het
Chd1 G A 17: 15,989,015 (GRCm39) W1589* probably null Het
Cldn19 A G 4: 119,112,951 (GRCm39) Q61R probably damaging Het
Cyp2a22 A G 7: 26,631,949 (GRCm39) S436P probably benign Het
Emc10 A C 7: 44,142,051 (GRCm39) V124G probably damaging Het
Enam A T 5: 88,650,885 (GRCm39) D723V probably benign Het
Eps8 C A 6: 137,504,128 (GRCm39) Q158H probably damaging Het
Ercc6 G A 14: 32,263,253 (GRCm39) D486N probably damaging Het
Fasn T C 11: 120,703,885 (GRCm39) E1485G possibly damaging Het
Fat2 T C 11: 55,169,844 (GRCm39) K2972E probably benign Het
Fbxw28 T C 9: 109,168,602 (GRCm39) K30R probably null Het
Flot2 T A 11: 77,948,339 (GRCm39) L164Q probably damaging Het
Fsip2 A T 2: 82,779,739 (GRCm39) I162L probably benign Het
Fsip2 A T 2: 82,815,815 (GRCm39) L3849F probably benign Het
Gabrb1 C G 5: 71,858,154 (GRCm39) P60R probably damaging Het
Galnt14 T C 17: 73,811,893 (GRCm39) R443G probably benign Het
Gas8 C T 8: 124,257,753 (GRCm39) T400M probably benign Het
Gfap T C 11: 102,785,214 (GRCm39) Y254C probably damaging Het
Git2 A G 5: 114,883,543 (GRCm39) S396P probably damaging Het
Glb1l3 A T 9: 26,740,349 (GRCm39) M327K probably benign Het
Gm10715 A C 9: 3,038,062 (GRCm39) probably benign Het
Gm10787 G A 10: 76,857,841 (GRCm39) noncoding transcript Het
Gm1123 T A 9: 98,900,622 (GRCm39) D78V probably damaging Het
Gm27013 T C 6: 130,655,079 (GRCm39) T128A probably benign Het
Gpbp1 A G 13: 111,577,164 (GRCm39) probably null Het
Gphn G A 12: 78,569,729 (GRCm39) probably null Het
Gpr157 A G 4: 150,186,823 (GRCm39) E317G probably benign Het
Gsdmc4 T A 15: 63,765,596 (GRCm39) M318L probably benign Het
Gtf2f2 A T 14: 76,248,131 (GRCm39) W19R probably damaging Het
Gvin-ps3 T C 7: 105,680,627 (GRCm39) noncoding transcript Het
Helb A G 10: 119,920,763 (GRCm39) V1060A probably benign Het
Igfn1 C T 1: 135,895,778 (GRCm39) G1596D probably benign Het
Il1rl2 T C 1: 40,366,547 (GRCm39) I27T possibly damaging Het
Inpp5j A G 11: 3,449,676 (GRCm39) V702A probably damaging Het
Kmt2d A C 15: 98,759,775 (GRCm39) V1161G unknown Het
Krtap1-3 T G 11: 99,481,715 (GRCm39) Y144S possibly damaging Het
Layn C T 9: 50,968,682 (GRCm39) V354M probably damaging Het
Lrba G A 3: 86,526,816 (GRCm39) probably null Het
Lrp8 T A 4: 107,727,234 (GRCm39) L893Q possibly damaging Het
Mrps9 T A 1: 42,937,575 (GRCm39) probably benign Het
Mug1 T A 6: 121,862,813 (GRCm39) M1387K probably damaging Het
Myo18b A C 5: 113,021,895 (GRCm39) V499G probably benign Het
Nbea T C 3: 55,618,091 (GRCm39) E2321G probably benign Het
Nrsn2 C T 2: 152,211,552 (GRCm39) V160I probably benign Het
Nup210 G A 6: 91,008,650 (GRCm39) Q510* probably null Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or2ag12 T G 7: 106,277,330 (GRCm39) D121A probably damaging Het
P3h3 G T 6: 124,827,600 (GRCm39) Q479K possibly damaging Het
Paqr9 T A 9: 95,442,723 (GRCm39) F238I probably damaging Het
Parp3 A T 9: 106,350,308 (GRCm39) L343H probably damaging Het
Pcdh18 A C 3: 49,699,117 (GRCm39) M1115R probably damaging Het
Pcdh8 A G 14: 80,008,308 (GRCm39) V85A possibly damaging Het
Pcdhb4 A G 18: 37,441,452 (GRCm39) N254S possibly damaging Het
Pld1 T C 3: 28,130,700 (GRCm39) V500A probably benign Het
Pramel29 T C 4: 143,935,144 (GRCm39) K199R probably damaging Het
Prkg2 A T 5: 99,129,002 (GRCm39) D311E probably benign Het
Prss42 T C 9: 110,628,369 (GRCm39) L171P probably damaging Het
Pth2 T A 7: 44,830,767 (GRCm39) L17H probably damaging Het
Reln A T 5: 22,223,844 (GRCm39) probably null Het
Rmi2 G T 16: 10,657,701 (GRCm39) V104L probably damaging Het
Rpusd4 T A 9: 35,179,831 (GRCm39) V108D probably damaging Het
Rufy4 C A 1: 74,168,198 (GRCm39) T82K possibly damaging Het
Scimp G A 11: 70,682,294 (GRCm39) Q141* probably null Het
Sel1l2 T C 2: 140,105,390 (GRCm39) T267A probably benign Het
Sema5a T A 15: 32,550,400 (GRCm39) S146R possibly damaging Het
Sh2d3c T C 2: 32,611,172 (GRCm39) M1T probably null Het
Slc30a6 T C 17: 74,712,716 (GRCm39) L71P probably damaging Het
Srrm3 A G 5: 135,883,449 (GRCm39) Y224C possibly damaging Het
Tacr3 A T 3: 134,560,615 (GRCm39) T185S possibly damaging Het
Tas2r140 T A 6: 133,032,528 (GRCm39) T77S probably benign Het
Thsd7b T C 1: 129,523,581 (GRCm39) V128A probably benign Het
Tnfrsf10b T G 14: 70,013,608 (GRCm39) H179Q probably damaging Het
Tonsl A G 15: 76,517,409 (GRCm39) V770A probably benign Het
Trim42 G A 9: 97,244,982 (GRCm39) P606L probably benign Het
Trim45 A T 3: 100,832,804 (GRCm39) T346S possibly damaging Het
Ttc28 C A 5: 111,433,947 (GRCm39) S2296Y probably damaging Het
Tube1 A G 10: 39,020,842 (GRCm39) N243D probably benign Het
Tvp23b G T 11: 62,770,424 (GRCm39) probably null Het
Ubxn11 T A 4: 133,836,919 (GRCm39) I49N probably damaging Het
Usp17le T A 7: 104,418,977 (GRCm39) E55V probably benign Het
Vmn2r114 A T 17: 23,510,353 (GRCm39) V709D probably damaging Het
Vmn2r129 G C 4: 156,685,733 (GRCm39) noncoding transcript Het
Vmn2r23 C T 6: 123,690,033 (GRCm39) T303M probably damaging Het
Vmn2r60 C T 7: 41,785,285 (GRCm39) P166S probably damaging Het
Vmn2r83 A G 10: 79,313,682 (GRCm39) I97V possibly damaging Het
Wbp2nl A T 15: 82,198,537 (GRCm39) K358M possibly damaging Het
Xpo1 T A 11: 23,228,183 (GRCm39) I150N probably damaging Het
Zfp113 G A 5: 138,143,687 (GRCm39) L188F probably damaging Het
Zfp189 T G 4: 49,529,984 (GRCm39) S362R probably damaging Het
Zfp593os A G 4: 133,972,587 (GRCm39) probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86,572,797 (GRCm39) missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86,611,821 (GRCm39) missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86,612,542 (GRCm39) missense probably benign
IGL01707:Ttc41 APN 10 86,612,631 (GRCm39) missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86,566,890 (GRCm39) missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86,612,488 (GRCm39) missense probably benign 0.03
IGL01918:Ttc41 APN 10 86,549,054 (GRCm39) missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86,611,815 (GRCm39) missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86,596,778 (GRCm39) nonsense probably null
IGL02887:Ttc41 APN 10 86,569,518 (GRCm39) missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86,572,721 (GRCm39) missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86,594,212 (GRCm39) missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86,560,278 (GRCm39) critical splice donor site probably null
IGL03242:Ttc41 APN 10 86,612,683 (GRCm39) makesense probably null
IGL03307:Ttc41 APN 10 86,580,304 (GRCm39) missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
BB013:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0379:Ttc41 UTSW 10 86,548,841 (GRCm39) missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86,599,811 (GRCm39) missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86,594,961 (GRCm39) missense probably benign 0.00
R1589:Ttc41 UTSW 10 86,612,254 (GRCm39) missense probably benign 0.01
R1599:Ttc41 UTSW 10 86,612,437 (GRCm39) missense probably benign 0.04
R1608:Ttc41 UTSW 10 86,611,857 (GRCm39) missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86,612,116 (GRCm39) missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86,612,078 (GRCm39) missense probably benign
R2398:Ttc41 UTSW 10 86,549,250 (GRCm39) missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86,560,238 (GRCm39) missense probably benign 0.42
R3117:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86,565,662 (GRCm39) missense possibly damaging 0.62
R4841:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4842:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4884:Ttc41 UTSW 10 86,566,882 (GRCm39) missense probably benign 0.00
R4885:Ttc41 UTSW 10 86,594,966 (GRCm39) missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86,612,056 (GRCm39) missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86,580,408 (GRCm39) missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86,566,806 (GRCm39) missense probably benign 0.13
R5268:Ttc41 UTSW 10 86,580,342 (GRCm39) missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86,612,443 (GRCm39) missense probably benign 0.04
R5301:Ttc41 UTSW 10 86,555,384 (GRCm39) missense probably benign 0.00
R5425:Ttc41 UTSW 10 86,612,494 (GRCm39) missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86,596,784 (GRCm39) critical splice donor site probably null
R5635:Ttc41 UTSW 10 86,572,841 (GRCm39) missense probably benign 0.09
R5752:Ttc41 UTSW 10 86,594,210 (GRCm39) missense probably benign 0.33
R5868:Ttc41 UTSW 10 86,586,128 (GRCm39) missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86,549,088 (GRCm39) missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86,594,952 (GRCm39) critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86,612,527 (GRCm39) missense probably benign 0.00
R6260:Ttc41 UTSW 10 86,569,571 (GRCm39) missense probably benign 0.32
R6260:Ttc41 UTSW 10 86,567,023 (GRCm39) missense probably benign 0.20
R6276:Ttc41 UTSW 10 86,580,313 (GRCm39) missense probably benign 0.01
R6458:Ttc41 UTSW 10 86,594,134 (GRCm39) missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86,549,367 (GRCm39) missense probably benign 0.17
R7348:Ttc41 UTSW 10 86,586,212 (GRCm39) nonsense probably null
R7382:Ttc41 UTSW 10 86,612,374 (GRCm39) missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86,549,296 (GRCm39) missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86,595,088 (GRCm39) missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86,612,495 (GRCm39) missense probably benign 0.02
R7926:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R7998:Ttc41 UTSW 10 86,572,711 (GRCm39) missense probably benign 0.01
R8021:Ttc41 UTSW 10 86,569,578 (GRCm39) missense probably benign
R8059:Ttc41 UTSW 10 86,548,842 (GRCm39) missense probably benign 0.01
R8170:Ttc41 UTSW 10 86,612,030 (GRCm39) missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86,555,494 (GRCm39) missense probably benign 0.06
R8375:Ttc41 UTSW 10 86,599,844 (GRCm39) missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86,555,390 (GRCm39) missense probably benign 0.00
R8698:Ttc41 UTSW 10 86,548,841 (GRCm39) missense probably benign 0.00
R8773:Ttc41 UTSW 10 86,565,679 (GRCm39) missense probably benign 0.35
R8902:Ttc41 UTSW 10 86,548,865 (GRCm39) missense probably benign 0.06
R8985:Ttc41 UTSW 10 86,566,956 (GRCm39) missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86,549,599 (GRCm39) missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86,569,625 (GRCm39) missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86,612,486 (GRCm39) missense probably benign 0.22
R9236:Ttc41 UTSW 10 86,612,594 (GRCm39) missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86,567,113 (GRCm39) missense probably benign 0.00
R9287:Ttc41 UTSW 10 86,599,830 (GRCm39) missense probably benign 0.43
R9345:Ttc41 UTSW 10 86,595,089 (GRCm39) missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86,548,890 (GRCm39) missense probably damaging 0.99
R9500:Ttc41 UTSW 10 86,565,726 (GRCm39) missense probably benign 0.03
R9570:Ttc41 UTSW 10 86,549,598 (GRCm39) missense possibly damaging 0.88
R9593:Ttc41 UTSW 10 86,549,049 (GRCm39) missense probably benign 0.24
X0024:Ttc41 UTSW 10 86,560,114 (GRCm39) missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86,565,661 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGTCTGTCCTGCAAGTC -3'
(R):5'- GAGCCATAAAGGAGGCACTTTTAG -3'

Sequencing Primer
(F):5'- CTGACGTGAAGATCGTGGAACTC -3'
(R):5'- GAGGCACTTTTAGGATCAGCTATCAC -3'
Posted On 2016-03-01