Incidental Mutation 'R4840:Vmn2r114'
ID 371781
Institutional Source Beutler Lab
Gene Symbol Vmn2r114
Ensembl Gene ENSMUSG00000091945
Gene Name vomeronasal 2, receptor 114
Synonyms EG666002
MMRRC Submission 042453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R4840 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 23509908-23531287 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23510353 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 709 (V709D)
Ref Sequence ENSEMBL: ENSMUSP00000127505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168033]
AlphaFold E9Q281
Predicted Effect probably damaging
Transcript: ENSMUST00000168033
AA Change: V709D

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945
AA Change: V709D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 470 1.5e-24 PFAM
Pfam:NCD3G 511 564 1.5e-18 PFAM
Pfam:7tm_3 597 832 1.4e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 97% (114/117)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C A 1: 85,974,166 (GRCm39) T161K probably benign Het
Actn3 G A 19: 4,914,539 (GRCm39) R530W probably damaging Het
Alg11 C T 8: 22,558,026 (GRCm39) A404V possibly damaging Het
Alkbh8 T A 9: 3,369,751 (GRCm39) V340D probably damaging Het
Arhgef12 T C 9: 42,886,364 (GRCm39) H1166R probably benign Het
Aspm T A 1: 139,398,269 (GRCm39) D978E possibly damaging Het
Bod1l C T 5: 41,975,815 (GRCm39) G1833D probably damaging Het
Brd3 A G 2: 27,339,251 (GRCm39) V676A possibly damaging Het
Brip1 G A 11: 86,037,009 (GRCm39) T454I possibly damaging Het
C3ar1 T C 6: 122,827,723 (GRCm39) I165V probably benign Het
Camta1 T A 4: 151,228,864 (GRCm39) Q656L probably benign Het
Casp14 A T 10: 78,549,178 (GRCm39) L256* probably null Het
Cdh23 G T 10: 60,255,556 (GRCm39) H773Q possibly damaging Het
Chd1 G T 17: 15,989,016 (GRCm39) D1590Y probably damaging Het
Chd1 G A 17: 15,989,015 (GRCm39) W1589* probably null Het
Cldn19 A G 4: 119,112,951 (GRCm39) Q61R probably damaging Het
Cyp2a22 A G 7: 26,631,949 (GRCm39) S436P probably benign Het
Emc10 A C 7: 44,142,051 (GRCm39) V124G probably damaging Het
Enam A T 5: 88,650,885 (GRCm39) D723V probably benign Het
Eps8 C A 6: 137,504,128 (GRCm39) Q158H probably damaging Het
Ercc6 G A 14: 32,263,253 (GRCm39) D486N probably damaging Het
Fasn T C 11: 120,703,885 (GRCm39) E1485G possibly damaging Het
Fat2 T C 11: 55,169,844 (GRCm39) K2972E probably benign Het
Fbxw28 T C 9: 109,168,602 (GRCm39) K30R probably null Het
Flot2 T A 11: 77,948,339 (GRCm39) L164Q probably damaging Het
Fsip2 A T 2: 82,779,739 (GRCm39) I162L probably benign Het
Fsip2 A T 2: 82,815,815 (GRCm39) L3849F probably benign Het
Gabrb1 C G 5: 71,858,154 (GRCm39) P60R probably damaging Het
Galnt14 T C 17: 73,811,893 (GRCm39) R443G probably benign Het
Gas8 C T 8: 124,257,753 (GRCm39) T400M probably benign Het
Gfap T C 11: 102,785,214 (GRCm39) Y254C probably damaging Het
Git2 A G 5: 114,883,543 (GRCm39) S396P probably damaging Het
Glb1l3 A T 9: 26,740,349 (GRCm39) M327K probably benign Het
Gm10715 A C 9: 3,038,062 (GRCm39) probably benign Het
Gm10787 G A 10: 76,857,841 (GRCm39) noncoding transcript Het
Gm1123 T A 9: 98,900,622 (GRCm39) D78V probably damaging Het
Gm27013 T C 6: 130,655,079 (GRCm39) T128A probably benign Het
Gpbp1 A G 13: 111,577,164 (GRCm39) probably null Het
Gphn G A 12: 78,569,729 (GRCm39) probably null Het
Gpr157 A G 4: 150,186,823 (GRCm39) E317G probably benign Het
Gsdmc4 T A 15: 63,765,596 (GRCm39) M318L probably benign Het
Gtf2f2 A T 14: 76,248,131 (GRCm39) W19R probably damaging Het
Gvin-ps3 T C 7: 105,680,627 (GRCm39) noncoding transcript Het
Helb A G 10: 119,920,763 (GRCm39) V1060A probably benign Het
Igfn1 C T 1: 135,895,778 (GRCm39) G1596D probably benign Het
Il1rl2 T C 1: 40,366,547 (GRCm39) I27T possibly damaging Het
Inpp5j A G 11: 3,449,676 (GRCm39) V702A probably damaging Het
Kmt2d A C 15: 98,759,775 (GRCm39) V1161G unknown Het
Krtap1-3 T G 11: 99,481,715 (GRCm39) Y144S possibly damaging Het
Layn C T 9: 50,968,682 (GRCm39) V354M probably damaging Het
Lrba G A 3: 86,526,816 (GRCm39) probably null Het
Lrp8 T A 4: 107,727,234 (GRCm39) L893Q possibly damaging Het
Mrps9 T A 1: 42,937,575 (GRCm39) probably benign Het
Mug1 T A 6: 121,862,813 (GRCm39) M1387K probably damaging Het
Myo18b A C 5: 113,021,895 (GRCm39) V499G probably benign Het
Nbea T C 3: 55,618,091 (GRCm39) E2321G probably benign Het
Nrsn2 C T 2: 152,211,552 (GRCm39) V160I probably benign Het
Nup210 G A 6: 91,008,650 (GRCm39) Q510* probably null Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or2ag12 T G 7: 106,277,330 (GRCm39) D121A probably damaging Het
P3h3 G T 6: 124,827,600 (GRCm39) Q479K possibly damaging Het
Paqr9 T A 9: 95,442,723 (GRCm39) F238I probably damaging Het
Parp3 A T 9: 106,350,308 (GRCm39) L343H probably damaging Het
Pcdh18 A C 3: 49,699,117 (GRCm39) M1115R probably damaging Het
Pcdh8 A G 14: 80,008,308 (GRCm39) V85A possibly damaging Het
Pcdhb4 A G 18: 37,441,452 (GRCm39) N254S possibly damaging Het
Pld1 T C 3: 28,130,700 (GRCm39) V500A probably benign Het
Pramel29 T C 4: 143,935,144 (GRCm39) K199R probably damaging Het
Prkg2 A T 5: 99,129,002 (GRCm39) D311E probably benign Het
Prss42 T C 9: 110,628,369 (GRCm39) L171P probably damaging Het
Pth2 T A 7: 44,830,767 (GRCm39) L17H probably damaging Het
Reln A T 5: 22,223,844 (GRCm39) probably null Het
Rmi2 G T 16: 10,657,701 (GRCm39) V104L probably damaging Het
Rpusd4 T A 9: 35,179,831 (GRCm39) V108D probably damaging Het
Rufy4 C A 1: 74,168,198 (GRCm39) T82K possibly damaging Het
Scimp G A 11: 70,682,294 (GRCm39) Q141* probably null Het
Sel1l2 T C 2: 140,105,390 (GRCm39) T267A probably benign Het
Sema5a T A 15: 32,550,400 (GRCm39) S146R possibly damaging Het
Sh2d3c T C 2: 32,611,172 (GRCm39) M1T probably null Het
Slc30a6 T C 17: 74,712,716 (GRCm39) L71P probably damaging Het
Srrm3 A G 5: 135,883,449 (GRCm39) Y224C possibly damaging Het
Tacr3 A T 3: 134,560,615 (GRCm39) T185S possibly damaging Het
Tas2r140 T A 6: 133,032,528 (GRCm39) T77S probably benign Het
Thsd7b T C 1: 129,523,581 (GRCm39) V128A probably benign Het
Tnfrsf10b T G 14: 70,013,608 (GRCm39) H179Q probably damaging Het
Tonsl A G 15: 76,517,409 (GRCm39) V770A probably benign Het
Trim42 G A 9: 97,244,982 (GRCm39) P606L probably benign Het
Trim45 A T 3: 100,832,804 (GRCm39) T346S possibly damaging Het
Ttc28 C A 5: 111,433,947 (GRCm39) S2296Y probably damaging Het
Ttc41 C T 10: 86,566,989 (GRCm39) R552C probably benign Het
Tube1 A G 10: 39,020,842 (GRCm39) N243D probably benign Het
Tvp23b G T 11: 62,770,424 (GRCm39) probably null Het
Ubxn11 T A 4: 133,836,919 (GRCm39) I49N probably damaging Het
Usp17le T A 7: 104,418,977 (GRCm39) E55V probably benign Het
Vmn2r129 G C 4: 156,685,733 (GRCm39) noncoding transcript Het
Vmn2r23 C T 6: 123,690,033 (GRCm39) T303M probably damaging Het
Vmn2r60 C T 7: 41,785,285 (GRCm39) P166S probably damaging Het
Vmn2r83 A G 10: 79,313,682 (GRCm39) I97V possibly damaging Het
Wbp2nl A T 15: 82,198,537 (GRCm39) K358M possibly damaging Het
Xpo1 T A 11: 23,228,183 (GRCm39) I150N probably damaging Het
Zfp113 G A 5: 138,143,687 (GRCm39) L188F probably damaging Het
Zfp189 T G 4: 49,529,984 (GRCm39) S362R probably damaging Het
Zfp593os A G 4: 133,972,587 (GRCm39) probably benign Het
Other mutations in Vmn2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Vmn2r114 APN 17 23,510,639 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23,510,212 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23,509,957 (GRCm39) missense probably benign 0.23
IGL00990:Vmn2r114 APN 17 23,509,939 (GRCm39) missense probably benign
IGL01838:Vmn2r114 APN 17 23,515,956 (GRCm39) missense probably benign 0.44
IGL01990:Vmn2r114 APN 17 23,529,355 (GRCm39) missense probably benign 0.22
IGL01994:Vmn2r114 APN 17 23,529,451 (GRCm39) missense probably damaging 1.00
IGL02153:Vmn2r114 APN 17 23,510,782 (GRCm39) missense probably benign 0.01
IGL02453:Vmn2r114 APN 17 23,530,108 (GRCm39) missense probably benign 0.00
IGL02621:Vmn2r114 APN 17 23,529,494 (GRCm39) missense probably damaging 0.98
IGL02938:Vmn2r114 APN 17 23,510,263 (GRCm39) missense probably benign 0.10
IGL03130:Vmn2r114 APN 17 23,515,970 (GRCm39) splice site probably benign
IGL03325:Vmn2r114 APN 17 23,510,652 (GRCm39) missense probably damaging 1.00
BB004:Vmn2r114 UTSW 17 23,510,619 (GRCm39) missense probably damaging 1.00
R0109:Vmn2r114 UTSW 17 23,529,549 (GRCm39) nonsense probably null
R0164:Vmn2r114 UTSW 17 23,528,800 (GRCm39) critical splice donor site probably null
R0310:Vmn2r114 UTSW 17 23,509,917 (GRCm39) missense probably benign 0.23
R0583:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R0677:Vmn2r114 UTSW 17 23,529,568 (GRCm39) missense probably damaging 1.00
R1127:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1147:Vmn2r114 UTSW 17 23,530,037 (GRCm39) missense probably benign 0.00
R1147:Vmn2r114 UTSW 17 23,530,037 (GRCm39) missense probably benign 0.00
R1157:Vmn2r114 UTSW 17 23,529,314 (GRCm39) missense possibly damaging 0.60
R1323:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1347:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1435:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1437:Vmn2r114 UTSW 17 23,510,185 (GRCm39) missense probably damaging 1.00
R1585:Vmn2r114 UTSW 17 23,510,675 (GRCm39) missense probably damaging 0.98
R1641:Vmn2r114 UTSW 17 23,515,962 (GRCm39) missense probably benign 0.00
R1748:Vmn2r114 UTSW 17 23,527,035 (GRCm39) missense probably benign 0.17
R1954:Vmn2r114 UTSW 17 23,530,086 (GRCm39) missense probably benign 0.32
R2081:Vmn2r114 UTSW 17 23,510,083 (GRCm39) missense possibly damaging 0.91
R2103:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2113:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2134:Vmn2r114 UTSW 17 23,510,737 (GRCm39) missense probably damaging 1.00
R2149:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2424:Vmn2r114 UTSW 17 23,515,842 (GRCm39) missense possibly damaging 0.90
R2847:Vmn2r114 UTSW 17 23,509,948 (GRCm39) missense probably benign 0.00
R2848:Vmn2r114 UTSW 17 23,509,948 (GRCm39) missense probably benign 0.00
R2893:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3017:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3018:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3019:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3020:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3021:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R4628:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R4668:Vmn2r114 UTSW 17 23,529,447 (GRCm39) missense possibly damaging 0.83
R4841:Vmn2r114 UTSW 17 23,529,336 (GRCm39) missense probably benign 0.04
R4842:Vmn2r114 UTSW 17 23,529,336 (GRCm39) missense probably benign 0.04
R4856:Vmn2r114 UTSW 17 23,527,008 (GRCm39) missense probably benign 0.11
R4886:Vmn2r114 UTSW 17 23,527,008 (GRCm39) missense probably benign 0.11
R4992:Vmn2r114 UTSW 17 23,510,765 (GRCm39) missense probably benign 0.03
R5182:Vmn2r114 UTSW 17 23,510,632 (GRCm39) missense probably damaging 0.96
R5223:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5405:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5449:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5615:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5834:Vmn2r114 UTSW 17 23,529,599 (GRCm39) missense possibly damaging 0.90
R6150:Vmn2r114 UTSW 17 23,510,269 (GRCm39) missense probably benign 0.03
R6277:Vmn2r114 UTSW 17 23,509,954 (GRCm39) missense possibly damaging 0.93
R6403:Vmn2r114 UTSW 17 23,528,939 (GRCm39) missense probably damaging 0.99
R6589:Vmn2r114 UTSW 17 23,510,642 (GRCm39) missense probably damaging 1.00
R6613:Vmn2r114 UTSW 17 23,529,220 (GRCm39) missense possibly damaging 0.82
R6747:Vmn2r114 UTSW 17 23,528,850 (GRCm39) missense probably benign 0.00
R6837:Vmn2r114 UTSW 17 23,529,176 (GRCm39) missense probably benign 0.10
R6911:Vmn2r114 UTSW 17 23,510,104 (GRCm39) missense probably damaging 0.98
R6950:Vmn2r114 UTSW 17 23,529,137 (GRCm39) missense probably benign 0.03
R7276:Vmn2r114 UTSW 17 23,509,934 (GRCm39) missense probably damaging 0.97
R7482:Vmn2r114 UTSW 17 23,510,468 (GRCm39) missense probably damaging 1.00
R7514:Vmn2r114 UTSW 17 23,527,035 (GRCm39) missense probably null 0.96
R7523:Vmn2r114 UTSW 17 23,529,611 (GRCm39) missense probably benign 0.01
R7563:Vmn2r114 UTSW 17 23,510,000 (GRCm39) missense probably benign 0.01
R7585:Vmn2r114 UTSW 17 23,510,239 (GRCm39) missense probably damaging 1.00
R7593:Vmn2r114 UTSW 17 23,510,817 (GRCm39) nonsense probably null
R7611:Vmn2r114 UTSW 17 23,515,944 (GRCm39) missense probably damaging 0.97
R7641:Vmn2r114 UTSW 17 23,527,177 (GRCm39) missense possibly damaging 0.53
R7651:Vmn2r114 UTSW 17 23,509,986 (GRCm39) nonsense probably null
R7970:Vmn2r114 UTSW 17 23,530,186 (GRCm39) missense probably benign 0.00
R8737:Vmn2r114 UTSW 17 23,529,142 (GRCm39) missense probably benign 0.36
R8802:Vmn2r114 UTSW 17 23,528,836 (GRCm39) missense possibly damaging 0.65
R8847:Vmn2r114 UTSW 17 23,528,986 (GRCm39) missense probably damaging 1.00
R8991:Vmn2r114 UTSW 17 23,529,286 (GRCm39) missense probably damaging 1.00
R9138:Vmn2r114 UTSW 17 23,510,578 (GRCm39) missense probably damaging 1.00
R9173:Vmn2r114 UTSW 17 23,510,527 (GRCm39) missense probably damaging 0.99
R9175:Vmn2r114 UTSW 17 23,527,212 (GRCm39) missense probably damaging 1.00
R9657:Vmn2r114 UTSW 17 23,510,690 (GRCm39) missense probably damaging 1.00
R9670:Vmn2r114 UTSW 17 23,531,098 (GRCm39) missense
X0065:Vmn2r114 UTSW 17 23,529,931 (GRCm39) missense probably benign 0.34
Z1088:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCAGAGTGAAGCTCCC -3'
(R):5'- AAGCACCACAGTACTCCAGTTG -3'

Sequencing Primer
(F):5'- AGTGAAGCTCCCAATGGC -3'
(R):5'- ACAGTACTCCAGTTGTTAAGGCC -3'
Posted On 2016-03-01