Incidental Mutation 'R4841:Lrguk'
ID 371818
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 042454-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R4841 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 34029448-34134034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34092867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 559 (V559A)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: V559A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: V559A

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228187
AA Change: V559A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4933427I04Rik T A 4: 123,860,377 M28K probably benign Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
A2m A T 6: 121,646,844 I390F probably benign Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamts6 A G 13: 104,312,787 D39G probably benign Het
Adgrl3 T C 5: 81,794,271 S1326P possibly damaging Het
Adgrv1 A G 13: 81,503,001 probably null Het
Ap3b2 G A 7: 81,477,930 A166V probably damaging Het
Bbox1 T A 2: 110,303,739 probably null Het
BC067074 G A 13: 113,366,190 G143D probably benign Het
Bckdk A G 7: 127,905,461 probably null Het
Cand1 C A 10: 119,213,546 probably null Het
Capn5 T C 7: 98,131,672 probably null Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Cnmd A G 14: 79,650,322 I153T possibly damaging Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dmrt2 G A 19: 25,677,667 G210D probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Dspp A T 5: 104,177,186 S472C unknown Het
Dspp G T 5: 104,177,187 S472I unknown Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fam19a5 C T 15: 87,625,436 probably benign Het
Fancd2 T C 6: 113,562,430 S239P probably damaging Het
Fbp2 C A 13: 62,854,913 Q108H probably benign Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Gpat2 C G 2: 127,433,967 T555S probably benign Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kat8 A G 7: 127,925,194 I415V probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Olfr1301 C G 2: 111,754,334 F28L probably benign Het
Olfr291 G T 7: 84,857,120 L250F probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Osbpl3 T A 6: 50,309,376 N623I probably damaging Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pex16 T G 2: 92,379,199 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Rreb1 G A 13: 37,916,526 C211Y probably benign Het
Rundc3b A G 5: 8,528,742 L222P probably damaging Het
Ryr3 T C 2: 112,648,373 N4405S probably damaging Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Slc4a10 T C 2: 62,257,595 V414A possibly damaging Het
Slc9a3 G T 13: 74,165,837 D755Y probably damaging Het
Snrpb2 C A 2: 143,068,317 F98L possibly damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Tshz2 T A 2: 169,886,247 I452N probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zbtb44 T G 9: 31,053,405 V37G probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5939:Lrguk UTSW 6 34078753 missense probably damaging 1.00
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
R8551:Lrguk UTSW 6 34116511 missense probably damaging 0.96
R8828:Lrguk UTSW 6 34103637 missense unknown
R8879:Lrguk UTSW 6 34029683 missense probably benign 0.00
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GTGATGTCCACAGTATAAGCTGTT -3'
(R):5'- CCATGACCTAAACTGGAAACTCA -3'

Sequencing Primer
(F):5'- GTCCACAGTATAAGCTGTTTCTGAC -3'
(R):5'- ATTTCCAAATCCAGGCGTGG -3'
Posted On 2016-03-01