Incidental Mutation 'R4841:Or5ae2'
ID 371829
Institutional Source Beutler Lab
Gene Symbol Or5ae2
Ensembl Gene ENSMUSG00000070460
Gene Name olfactory receptor family 5 subfamily AE member 2
Synonyms GA_x6K02T2NHDJ-11231385-11230438, Olfr291, MOR254-2
MMRRC Submission 042454-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R4841 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 84502779-84506526 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 84506328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 250 (L250F)
Ref Sequence ENSEMBL: ENSMUSP00000150934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000211582] [ENSMUST00000217039]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000077303
Gene: ENSMUSG00000070460
AA Change: L250F

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 270 1.5e-10 PFAM
Pfam:7tm_1 43 293 1.9e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211582
AA Change: L252F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217039
AA Change: L250F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 15,164,001 (GRCm39) I43L possibly damaging Het
4933427I04Rik T A 4: 123,754,170 (GRCm39) M28K probably benign Het
A2m A T 6: 121,623,803 (GRCm39) I390F probably benign Het
Abcc8 T C 7: 45,800,252 (GRCm39) K510R probably damaging Het
Adamts6 A G 13: 104,449,295 (GRCm39) D39G probably benign Het
Adgrl3 T C 5: 81,942,118 (GRCm39) S1326P possibly damaging Het
Adgrv1 A G 13: 81,651,120 (GRCm39) probably null Het
Ap3b2 G A 7: 81,127,678 (GRCm39) A166V probably damaging Het
Bbox1 T A 2: 110,134,084 (GRCm39) probably null Het
Bckdk A G 7: 127,504,633 (GRCm39) probably null Het
Cand1 C A 10: 119,049,451 (GRCm39) probably null Het
Capn5 T C 7: 97,780,879 (GRCm39) probably null Het
Ccdc121rt2 A T 5: 112,598,106 (GRCm39) K218* probably null Het
Cd209c G T 8: 3,995,905 (GRCm39) R2S probably benign Het
Ces1g C T 8: 94,060,323 (GRCm39) E99K probably benign Het
Cnmd A G 14: 79,887,762 (GRCm39) I153T possibly damaging Het
Cntrob C G 11: 69,206,220 (GRCm39) L315F possibly damaging Het
Cspg4b G A 13: 113,502,724 (GRCm39) G143D probably benign Het
Ctdp1 A G 18: 80,451,941 (GRCm39) S145P unknown Het
Dmrt2 G A 19: 25,655,031 (GRCm39) G210D probably damaging Het
Dnajc16 A G 4: 141,501,936 (GRCm39) F298S probably damaging Het
Dock5 T C 14: 68,055,012 (GRCm39) D618G probably damaging Het
Drc3 G A 11: 60,261,361 (GRCm39) A171T probably benign Het
Dspp A T 5: 104,325,052 (GRCm39) S472C unknown Het
Dspp G T 5: 104,325,053 (GRCm39) S472I unknown Het
Ecel1 A T 1: 87,081,023 (GRCm39) N322K probably damaging Het
Eftud2 A G 11: 102,745,640 (GRCm39) F362L probably damaging Het
Egfr C T 11: 16,861,607 (GRCm39) H1129Y probably benign Het
Erich3 T A 3: 154,410,480 (GRCm39) F112I possibly damaging Het
Fam107b T C 2: 3,779,580 (GRCm39) L261S probably damaging Het
Fancd2 T C 6: 113,539,391 (GRCm39) S239P probably damaging Het
Fbp2 C A 13: 63,002,727 (GRCm39) Q108H probably benign Het
Fcgbpl1 T A 7: 27,850,147 (GRCm39) C1198S probably damaging Het
Gask1b G A 3: 79,843,912 (GRCm39) R377H probably damaging Het
Gipr C T 7: 18,896,601 (GRCm39) R165H probably damaging Het
Gje1 C T 10: 14,593,082 (GRCm39) G45R probably null Het
Gpat2 C G 2: 127,275,887 (GRCm39) T555S probably benign Het
Grik3 C A 4: 125,584,969 (GRCm39) N612K probably damaging Het
Iqcb1 A G 16: 36,655,952 (GRCm39) E113G probably benign Het
Kat8 A G 7: 127,524,366 (GRCm39) I415V probably benign Het
Kcnk10 A T 12: 98,401,175 (GRCm39) M486K probably benign Het
Kif21b C A 1: 136,072,958 (GRCm39) H119N probably damaging Het
Leng9 T C 7: 4,152,385 (GRCm39) D97G probably damaging Het
Lrguk T C 6: 34,069,802 (GRCm39) V559A probably damaging Het
Lrp1 G T 10: 127,419,805 (GRCm39) R935S probably damaging Het
Lrrcc1 C A 3: 14,627,571 (GRCm39) D503E probably benign Het
Mybph A T 1: 134,126,233 (GRCm39) E349V probably damaging Het
Myzap A G 9: 71,456,037 (GRCm39) S328P probably damaging Het
Nbeal1 T C 1: 60,292,534 (GRCm39) L1062P probably damaging Het
Nepro G A 16: 44,555,160 (GRCm39) S412N probably null Het
Nudt5 T C 2: 5,869,239 (GRCm39) V155A probably benign Het
Or13a25 A T 7: 140,247,502 (GRCm39) I94F probably damaging Het
Or4k51 C G 2: 111,584,679 (GRCm39) F28L probably benign Het
Or6ae1 A G 7: 139,742,602 (GRCm39) L87P possibly damaging Het
Osbpl3 T A 6: 50,286,356 (GRCm39) N623I probably damaging Het
Pde4dip T A 3: 97,700,844 (GRCm39) H220L probably damaging Het
Pde9a T A 17: 31,662,135 (GRCm39) probably null Het
Pex16 T G 2: 92,209,544 (GRCm39) probably null Het
Pnpla7 A G 2: 24,870,064 (GRCm39) T15A probably benign Het
Polq G T 16: 36,869,145 (GRCm39) probably null Het
Ppfia2 C T 10: 106,690,818 (GRCm39) T553I probably benign Het
Rreb1 G A 13: 38,100,502 (GRCm39) C211Y probably benign Het
Rundc3b A G 5: 8,578,742 (GRCm39) L222P probably damaging Het
Ryr3 T C 2: 112,478,718 (GRCm39) N4405S probably damaging Het
Sardh A G 2: 27,081,967 (GRCm39) V853A probably benign Het
Scfd1 T C 12: 51,436,109 (GRCm39) V86A probably damaging Het
Scube3 G A 17: 28,383,097 (GRCm39) C425Y probably damaging Het
Sfta2 T C 17: 35,960,773 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,031,049 (GRCm39) Y738H probably damaging Het
Shc2 T C 10: 79,458,295 (GRCm39) R463G probably damaging Het
Slc4a10 T C 2: 62,087,939 (GRCm39) V414A possibly damaging Het
Slc9a3 G T 13: 74,313,956 (GRCm39) D755Y probably damaging Het
Snrpb2 C A 2: 142,910,237 (GRCm39) F98L possibly damaging Het
Socs7 T A 11: 97,267,829 (GRCm39) I320N possibly damaging Het
Speer2 A T 16: 69,654,988 (GRCm39) M159K probably benign Het
Sppl2c A C 11: 104,078,478 (GRCm39) H426P probably benign Het
Stxbp5 C A 10: 9,638,635 (GRCm39) V1055L probably benign Het
Synpo A T 18: 60,736,684 (GRCm39) S421T probably damaging Het
Taf6l A G 19: 8,759,770 (GRCm39) V135A possibly damaging Het
Tafa5 C T 15: 87,509,637 (GRCm39) probably benign Het
Trim58 G A 11: 58,542,150 (GRCm39) G370E probably damaging Het
Tshz2 T A 2: 169,728,167 (GRCm39) I452N probably damaging Het
Ttc41 C T 10: 86,566,989 (GRCm39) R552C probably benign Het
Vit T C 17: 78,909,308 (GRCm39) S252P probably benign Het
Vmn1r173 A T 7: 23,402,361 (GRCm39) I199F probably damaging Het
Vmn2r114 T A 17: 23,529,336 (GRCm39) R255S probably benign Het
Vmn2r17 A G 5: 109,582,246 (GRCm39) N545S probably damaging Het
Zbtb44 T G 9: 30,964,701 (GRCm39) V37G probably damaging Het
Zfp865 A G 7: 5,034,640 (GRCm39) Y875C probably damaging Het
Other mutations in Or5ae2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Or5ae2 APN 7 84,505,619 (GRCm39) missense probably damaging 1.00
IGL02643:Or5ae2 APN 7 84,506,239 (GRCm39) missense probably damaging 1.00
IGL02928:Or5ae2 APN 7 84,506,273 (GRCm39) missense probably benign 0.08
IGL03124:Or5ae2 APN 7 84,505,931 (GRCm39) missense probably damaging 0.99
R0129:Or5ae2 UTSW 7 84,506,196 (GRCm39) missense probably benign
R0605:Or5ae2 UTSW 7 84,506,345 (GRCm39) missense probably damaging 1.00
R1085:Or5ae2 UTSW 7 84,505,987 (GRCm39) missense probably benign 0.05
R1477:Or5ae2 UTSW 7 84,506,225 (GRCm39) missense probably damaging 1.00
R1834:Or5ae2 UTSW 7 84,505,690 (GRCm39) missense probably damaging 0.99
R1839:Or5ae2 UTSW 7 84,505,756 (GRCm39) missense probably damaging 1.00
R2036:Or5ae2 UTSW 7 84,505,566 (GRCm39) start gained probably benign
R4214:Or5ae2 UTSW 7 84,506,497 (GRCm39) missense probably benign
R4386:Or5ae2 UTSW 7 84,505,756 (GRCm39) missense probably damaging 1.00
R4679:Or5ae2 UTSW 7 84,506,112 (GRCm39) nonsense probably null
R4789:Or5ae2 UTSW 7 84,506,509 (GRCm39) missense probably benign 0.09
R5011:Or5ae2 UTSW 7 84,505,646 (GRCm39) missense probably damaging 1.00
R5013:Or5ae2 UTSW 7 84,505,646 (GRCm39) missense probably damaging 1.00
R6127:Or5ae2 UTSW 7 84,506,410 (GRCm39) missense probably damaging 1.00
R7164:Or5ae2 UTSW 7 84,506,251 (GRCm39) missense possibly damaging 0.73
R7328:Or5ae2 UTSW 7 84,506,507 (GRCm39) missense probably benign 0.01
R8347:Or5ae2 UTSW 7 84,505,963 (GRCm39) missense probably damaging 0.99
R8434:Or5ae2 UTSW 7 84,506,497 (GRCm39) missense probably benign
R8882:Or5ae2 UTSW 7 84,505,681 (GRCm39) missense probably damaging 1.00
R9242:Or5ae2 UTSW 7 84,506,086 (GRCm39) nonsense probably null
R9640:Or5ae2 UTSW 7 84,506,114 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGCTCATCCACCTATATGG -3'
(R):5'- AGAAGTCTTACATCATGCTGTCTGTG -3'

Sequencing Primer
(F):5'- TCATCCACCTATATGGCAGAAGTG -3'
(R):5'- GCTGTCTGTGAACATATCCGAAG -3'
Posted On 2016-03-01