Incidental Mutation 'R4841:Ttc41'
ID 371843
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms BC030307, Gnn
MMRRC Submission 042454-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R4841 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86541675-86612708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86566989 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 552 (R552C)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070435
SMART Domains Protein: ENSMUSP00000136633
Gene: ENSMUSG00000056366

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 6.5e-13 PFAM
Pfam:Lipocalin 6 132 2.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: R552C

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: R552C

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: R552C

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 15,164,001 (GRCm39) I43L possibly damaging Het
4933427I04Rik T A 4: 123,754,170 (GRCm39) M28K probably benign Het
A2m A T 6: 121,623,803 (GRCm39) I390F probably benign Het
Abcc8 T C 7: 45,800,252 (GRCm39) K510R probably damaging Het
Adamts6 A G 13: 104,449,295 (GRCm39) D39G probably benign Het
Adgrl3 T C 5: 81,942,118 (GRCm39) S1326P possibly damaging Het
Adgrv1 A G 13: 81,651,120 (GRCm39) probably null Het
Ap3b2 G A 7: 81,127,678 (GRCm39) A166V probably damaging Het
Bbox1 T A 2: 110,134,084 (GRCm39) probably null Het
Bckdk A G 7: 127,504,633 (GRCm39) probably null Het
Cand1 C A 10: 119,049,451 (GRCm39) probably null Het
Capn5 T C 7: 97,780,879 (GRCm39) probably null Het
Ccdc121rt2 A T 5: 112,598,106 (GRCm39) K218* probably null Het
Cd209c G T 8: 3,995,905 (GRCm39) R2S probably benign Het
Ces1g C T 8: 94,060,323 (GRCm39) E99K probably benign Het
Cnmd A G 14: 79,887,762 (GRCm39) I153T possibly damaging Het
Cntrob C G 11: 69,206,220 (GRCm39) L315F possibly damaging Het
Cspg4b G A 13: 113,502,724 (GRCm39) G143D probably benign Het
Ctdp1 A G 18: 80,451,941 (GRCm39) S145P unknown Het
Dmrt2 G A 19: 25,655,031 (GRCm39) G210D probably damaging Het
Dnajc16 A G 4: 141,501,936 (GRCm39) F298S probably damaging Het
Dock5 T C 14: 68,055,012 (GRCm39) D618G probably damaging Het
Drc3 G A 11: 60,261,361 (GRCm39) A171T probably benign Het
Dspp A T 5: 104,325,052 (GRCm39) S472C unknown Het
Dspp G T 5: 104,325,053 (GRCm39) S472I unknown Het
Ecel1 A T 1: 87,081,023 (GRCm39) N322K probably damaging Het
Eftud2 A G 11: 102,745,640 (GRCm39) F362L probably damaging Het
Egfr C T 11: 16,861,607 (GRCm39) H1129Y probably benign Het
Erich3 T A 3: 154,410,480 (GRCm39) F112I possibly damaging Het
Fam107b T C 2: 3,779,580 (GRCm39) L261S probably damaging Het
Fancd2 T C 6: 113,539,391 (GRCm39) S239P probably damaging Het
Fbp2 C A 13: 63,002,727 (GRCm39) Q108H probably benign Het
Fcgbpl1 T A 7: 27,850,147 (GRCm39) C1198S probably damaging Het
Gask1b G A 3: 79,843,912 (GRCm39) R377H probably damaging Het
Gipr C T 7: 18,896,601 (GRCm39) R165H probably damaging Het
Gje1 C T 10: 14,593,082 (GRCm39) G45R probably null Het
Gpat2 C G 2: 127,275,887 (GRCm39) T555S probably benign Het
Grik3 C A 4: 125,584,969 (GRCm39) N612K probably damaging Het
Iqcb1 A G 16: 36,655,952 (GRCm39) E113G probably benign Het
Kat8 A G 7: 127,524,366 (GRCm39) I415V probably benign Het
Kcnk10 A T 12: 98,401,175 (GRCm39) M486K probably benign Het
Kif21b C A 1: 136,072,958 (GRCm39) H119N probably damaging Het
Leng9 T C 7: 4,152,385 (GRCm39) D97G probably damaging Het
Lrguk T C 6: 34,069,802 (GRCm39) V559A probably damaging Het
Lrp1 G T 10: 127,419,805 (GRCm39) R935S probably damaging Het
Lrrcc1 C A 3: 14,627,571 (GRCm39) D503E probably benign Het
Mybph A T 1: 134,126,233 (GRCm39) E349V probably damaging Het
Myzap A G 9: 71,456,037 (GRCm39) S328P probably damaging Het
Nbeal1 T C 1: 60,292,534 (GRCm39) L1062P probably damaging Het
Nepro G A 16: 44,555,160 (GRCm39) S412N probably null Het
Nudt5 T C 2: 5,869,239 (GRCm39) V155A probably benign Het
Or13a25 A T 7: 140,247,502 (GRCm39) I94F probably damaging Het
Or4k51 C G 2: 111,584,679 (GRCm39) F28L probably benign Het
Or5ae2 G T 7: 84,506,328 (GRCm39) L250F probably damaging Het
Or6ae1 A G 7: 139,742,602 (GRCm39) L87P possibly damaging Het
Osbpl3 T A 6: 50,286,356 (GRCm39) N623I probably damaging Het
Pde4dip T A 3: 97,700,844 (GRCm39) H220L probably damaging Het
Pde9a T A 17: 31,662,135 (GRCm39) probably null Het
Pex16 T G 2: 92,209,544 (GRCm39) probably null Het
Pnpla7 A G 2: 24,870,064 (GRCm39) T15A probably benign Het
Polq G T 16: 36,869,145 (GRCm39) probably null Het
Ppfia2 C T 10: 106,690,818 (GRCm39) T553I probably benign Het
Rreb1 G A 13: 38,100,502 (GRCm39) C211Y probably benign Het
Rundc3b A G 5: 8,578,742 (GRCm39) L222P probably damaging Het
Ryr3 T C 2: 112,478,718 (GRCm39) N4405S probably damaging Het
Sardh A G 2: 27,081,967 (GRCm39) V853A probably benign Het
Scfd1 T C 12: 51,436,109 (GRCm39) V86A probably damaging Het
Scube3 G A 17: 28,383,097 (GRCm39) C425Y probably damaging Het
Sfta2 T C 17: 35,960,773 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,031,049 (GRCm39) Y738H probably damaging Het
Shc2 T C 10: 79,458,295 (GRCm39) R463G probably damaging Het
Slc4a10 T C 2: 62,087,939 (GRCm39) V414A possibly damaging Het
Slc9a3 G T 13: 74,313,956 (GRCm39) D755Y probably damaging Het
Snrpb2 C A 2: 142,910,237 (GRCm39) F98L possibly damaging Het
Socs7 T A 11: 97,267,829 (GRCm39) I320N possibly damaging Het
Speer2 A T 16: 69,654,988 (GRCm39) M159K probably benign Het
Sppl2c A C 11: 104,078,478 (GRCm39) H426P probably benign Het
Stxbp5 C A 10: 9,638,635 (GRCm39) V1055L probably benign Het
Synpo A T 18: 60,736,684 (GRCm39) S421T probably damaging Het
Taf6l A G 19: 8,759,770 (GRCm39) V135A possibly damaging Het
Tafa5 C T 15: 87,509,637 (GRCm39) probably benign Het
Trim58 G A 11: 58,542,150 (GRCm39) G370E probably damaging Het
Tshz2 T A 2: 169,728,167 (GRCm39) I452N probably damaging Het
Vit T C 17: 78,909,308 (GRCm39) S252P probably benign Het
Vmn1r173 A T 7: 23,402,361 (GRCm39) I199F probably damaging Het
Vmn2r114 T A 17: 23,529,336 (GRCm39) R255S probably benign Het
Vmn2r17 A G 5: 109,582,246 (GRCm39) N545S probably damaging Het
Zbtb44 T G 9: 30,964,701 (GRCm39) V37G probably damaging Het
Zfp865 A G 7: 5,034,640 (GRCm39) Y875C probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86,572,797 (GRCm39) missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86,611,821 (GRCm39) missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86,612,542 (GRCm39) missense probably benign
IGL01707:Ttc41 APN 10 86,612,631 (GRCm39) missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86,566,890 (GRCm39) missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86,612,488 (GRCm39) missense probably benign 0.03
IGL01918:Ttc41 APN 10 86,549,054 (GRCm39) missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86,611,815 (GRCm39) missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86,596,778 (GRCm39) nonsense probably null
IGL02887:Ttc41 APN 10 86,569,518 (GRCm39) missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86,572,721 (GRCm39) missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86,594,212 (GRCm39) missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86,560,278 (GRCm39) critical splice donor site probably null
IGL03242:Ttc41 APN 10 86,612,683 (GRCm39) makesense probably null
IGL03307:Ttc41 APN 10 86,580,304 (GRCm39) missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
BB013:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0379:Ttc41 UTSW 10 86,548,841 (GRCm39) missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86,599,811 (GRCm39) missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86,594,961 (GRCm39) missense probably benign 0.00
R1589:Ttc41 UTSW 10 86,612,254 (GRCm39) missense probably benign 0.01
R1599:Ttc41 UTSW 10 86,612,437 (GRCm39) missense probably benign 0.04
R1608:Ttc41 UTSW 10 86,611,857 (GRCm39) missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86,612,116 (GRCm39) missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86,612,078 (GRCm39) missense probably benign
R2398:Ttc41 UTSW 10 86,549,250 (GRCm39) missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86,560,238 (GRCm39) missense probably benign 0.42
R3117:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86,565,662 (GRCm39) missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4842:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4884:Ttc41 UTSW 10 86,566,882 (GRCm39) missense probably benign 0.00
R4885:Ttc41 UTSW 10 86,594,966 (GRCm39) missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86,612,056 (GRCm39) missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86,580,408 (GRCm39) missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86,566,806 (GRCm39) missense probably benign 0.13
R5268:Ttc41 UTSW 10 86,580,342 (GRCm39) missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86,612,443 (GRCm39) missense probably benign 0.04
R5301:Ttc41 UTSW 10 86,555,384 (GRCm39) missense probably benign 0.00
R5425:Ttc41 UTSW 10 86,612,494 (GRCm39) missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86,596,784 (GRCm39) critical splice donor site probably null
R5635:Ttc41 UTSW 10 86,572,841 (GRCm39) missense probably benign 0.09
R5752:Ttc41 UTSW 10 86,594,210 (GRCm39) missense probably benign 0.33
R5868:Ttc41 UTSW 10 86,586,128 (GRCm39) missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86,549,088 (GRCm39) missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86,594,952 (GRCm39) critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86,612,527 (GRCm39) missense probably benign 0.00
R6260:Ttc41 UTSW 10 86,569,571 (GRCm39) missense probably benign 0.32
R6260:Ttc41 UTSW 10 86,567,023 (GRCm39) missense probably benign 0.20
R6276:Ttc41 UTSW 10 86,580,313 (GRCm39) missense probably benign 0.01
R6458:Ttc41 UTSW 10 86,594,134 (GRCm39) missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86,549,367 (GRCm39) missense probably benign 0.17
R7348:Ttc41 UTSW 10 86,586,212 (GRCm39) nonsense probably null
R7382:Ttc41 UTSW 10 86,612,374 (GRCm39) missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86,549,296 (GRCm39) missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86,595,088 (GRCm39) missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86,612,495 (GRCm39) missense probably benign 0.02
R7926:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R7998:Ttc41 UTSW 10 86,572,711 (GRCm39) missense probably benign 0.01
R8021:Ttc41 UTSW 10 86,569,578 (GRCm39) missense probably benign
R8059:Ttc41 UTSW 10 86,548,842 (GRCm39) missense probably benign 0.01
R8170:Ttc41 UTSW 10 86,612,030 (GRCm39) missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86,555,494 (GRCm39) missense probably benign 0.06
R8375:Ttc41 UTSW 10 86,599,844 (GRCm39) missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86,555,390 (GRCm39) missense probably benign 0.00
R8698:Ttc41 UTSW 10 86,548,841 (GRCm39) missense probably benign 0.00
R8773:Ttc41 UTSW 10 86,565,679 (GRCm39) missense probably benign 0.35
R8902:Ttc41 UTSW 10 86,548,865 (GRCm39) missense probably benign 0.06
R8985:Ttc41 UTSW 10 86,566,956 (GRCm39) missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86,549,599 (GRCm39) missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86,569,625 (GRCm39) missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86,612,486 (GRCm39) missense probably benign 0.22
R9236:Ttc41 UTSW 10 86,612,594 (GRCm39) missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86,567,113 (GRCm39) missense probably benign 0.00
R9287:Ttc41 UTSW 10 86,599,830 (GRCm39) missense probably benign 0.43
R9345:Ttc41 UTSW 10 86,595,089 (GRCm39) missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86,548,890 (GRCm39) missense probably damaging 0.99
R9500:Ttc41 UTSW 10 86,565,726 (GRCm39) missense probably benign 0.03
R9570:Ttc41 UTSW 10 86,549,598 (GRCm39) missense possibly damaging 0.88
R9593:Ttc41 UTSW 10 86,549,049 (GRCm39) missense probably benign 0.24
X0024:Ttc41 UTSW 10 86,560,114 (GRCm39) missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86,565,661 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGTCTGTCCTGCAAGTC -3'
(R):5'- AAAGGAGGCACTTTTAGGATCAGC -3'

Sequencing Primer
(F):5'- CTGACGTGAAGATCGTGGAACTC -3'
(R):5'- GAGGCACTTTTAGGATCAGCTATCAC -3'
Posted On 2016-03-01