Incidental Mutation 'R4841:Egfr'
ID 371845
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Name epidermal growth factor receptor
Synonyms 9030024J15Rik, avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, Errb1, Erbb
MMRRC Submission 042454-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.933) question?
Stock # R4841 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 16702203-16868158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 16861607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1129 (H1129Y)
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329]
AlphaFold Q01279
Predicted Effect probably benign
Transcript: ENSMUST00000020329
AA Change: H1129Y

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: H1129Y

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138518
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 15,164,001 (GRCm39) I43L possibly damaging Het
4933427I04Rik T A 4: 123,754,170 (GRCm39) M28K probably benign Het
A2m A T 6: 121,623,803 (GRCm39) I390F probably benign Het
Abcc8 T C 7: 45,800,252 (GRCm39) K510R probably damaging Het
Adamts6 A G 13: 104,449,295 (GRCm39) D39G probably benign Het
Adgrl3 T C 5: 81,942,118 (GRCm39) S1326P possibly damaging Het
Adgrv1 A G 13: 81,651,120 (GRCm39) probably null Het
Ap3b2 G A 7: 81,127,678 (GRCm39) A166V probably damaging Het
Bbox1 T A 2: 110,134,084 (GRCm39) probably null Het
Bckdk A G 7: 127,504,633 (GRCm39) probably null Het
Cand1 C A 10: 119,049,451 (GRCm39) probably null Het
Capn5 T C 7: 97,780,879 (GRCm39) probably null Het
Ccdc121rt2 A T 5: 112,598,106 (GRCm39) K218* probably null Het
Cd209c G T 8: 3,995,905 (GRCm39) R2S probably benign Het
Ces1g C T 8: 94,060,323 (GRCm39) E99K probably benign Het
Cnmd A G 14: 79,887,762 (GRCm39) I153T possibly damaging Het
Cntrob C G 11: 69,206,220 (GRCm39) L315F possibly damaging Het
Cspg4b G A 13: 113,502,724 (GRCm39) G143D probably benign Het
Ctdp1 A G 18: 80,451,941 (GRCm39) S145P unknown Het
Dmrt2 G A 19: 25,655,031 (GRCm39) G210D probably damaging Het
Dnajc16 A G 4: 141,501,936 (GRCm39) F298S probably damaging Het
Dock5 T C 14: 68,055,012 (GRCm39) D618G probably damaging Het
Drc3 G A 11: 60,261,361 (GRCm39) A171T probably benign Het
Dspp A T 5: 104,325,052 (GRCm39) S472C unknown Het
Dspp G T 5: 104,325,053 (GRCm39) S472I unknown Het
Ecel1 A T 1: 87,081,023 (GRCm39) N322K probably damaging Het
Eftud2 A G 11: 102,745,640 (GRCm39) F362L probably damaging Het
Erich3 T A 3: 154,410,480 (GRCm39) F112I possibly damaging Het
Fam107b T C 2: 3,779,580 (GRCm39) L261S probably damaging Het
Fancd2 T C 6: 113,539,391 (GRCm39) S239P probably damaging Het
Fbp2 C A 13: 63,002,727 (GRCm39) Q108H probably benign Het
Fcgbpl1 T A 7: 27,850,147 (GRCm39) C1198S probably damaging Het
Gask1b G A 3: 79,843,912 (GRCm39) R377H probably damaging Het
Gipr C T 7: 18,896,601 (GRCm39) R165H probably damaging Het
Gje1 C T 10: 14,593,082 (GRCm39) G45R probably null Het
Gpat2 C G 2: 127,275,887 (GRCm39) T555S probably benign Het
Grik3 C A 4: 125,584,969 (GRCm39) N612K probably damaging Het
Iqcb1 A G 16: 36,655,952 (GRCm39) E113G probably benign Het
Kat8 A G 7: 127,524,366 (GRCm39) I415V probably benign Het
Kcnk10 A T 12: 98,401,175 (GRCm39) M486K probably benign Het
Kif21b C A 1: 136,072,958 (GRCm39) H119N probably damaging Het
Leng9 T C 7: 4,152,385 (GRCm39) D97G probably damaging Het
Lrguk T C 6: 34,069,802 (GRCm39) V559A probably damaging Het
Lrp1 G T 10: 127,419,805 (GRCm39) R935S probably damaging Het
Lrrcc1 C A 3: 14,627,571 (GRCm39) D503E probably benign Het
Mybph A T 1: 134,126,233 (GRCm39) E349V probably damaging Het
Myzap A G 9: 71,456,037 (GRCm39) S328P probably damaging Het
Nbeal1 T C 1: 60,292,534 (GRCm39) L1062P probably damaging Het
Nepro G A 16: 44,555,160 (GRCm39) S412N probably null Het
Nudt5 T C 2: 5,869,239 (GRCm39) V155A probably benign Het
Or13a25 A T 7: 140,247,502 (GRCm39) I94F probably damaging Het
Or4k51 C G 2: 111,584,679 (GRCm39) F28L probably benign Het
Or5ae2 G T 7: 84,506,328 (GRCm39) L250F probably damaging Het
Or6ae1 A G 7: 139,742,602 (GRCm39) L87P possibly damaging Het
Osbpl3 T A 6: 50,286,356 (GRCm39) N623I probably damaging Het
Pde4dip T A 3: 97,700,844 (GRCm39) H220L probably damaging Het
Pde9a T A 17: 31,662,135 (GRCm39) probably null Het
Pex16 T G 2: 92,209,544 (GRCm39) probably null Het
Pnpla7 A G 2: 24,870,064 (GRCm39) T15A probably benign Het
Polq G T 16: 36,869,145 (GRCm39) probably null Het
Ppfia2 C T 10: 106,690,818 (GRCm39) T553I probably benign Het
Rreb1 G A 13: 38,100,502 (GRCm39) C211Y probably benign Het
Rundc3b A G 5: 8,578,742 (GRCm39) L222P probably damaging Het
Ryr3 T C 2: 112,478,718 (GRCm39) N4405S probably damaging Het
Sardh A G 2: 27,081,967 (GRCm39) V853A probably benign Het
Scfd1 T C 12: 51,436,109 (GRCm39) V86A probably damaging Het
Scube3 G A 17: 28,383,097 (GRCm39) C425Y probably damaging Het
Sfta2 T C 17: 35,960,773 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,031,049 (GRCm39) Y738H probably damaging Het
Shc2 T C 10: 79,458,295 (GRCm39) R463G probably damaging Het
Slc4a10 T C 2: 62,087,939 (GRCm39) V414A possibly damaging Het
Slc9a3 G T 13: 74,313,956 (GRCm39) D755Y probably damaging Het
Snrpb2 C A 2: 142,910,237 (GRCm39) F98L possibly damaging Het
Socs7 T A 11: 97,267,829 (GRCm39) I320N possibly damaging Het
Speer2 A T 16: 69,654,988 (GRCm39) M159K probably benign Het
Sppl2c A C 11: 104,078,478 (GRCm39) H426P probably benign Het
Stxbp5 C A 10: 9,638,635 (GRCm39) V1055L probably benign Het
Synpo A T 18: 60,736,684 (GRCm39) S421T probably damaging Het
Taf6l A G 19: 8,759,770 (GRCm39) V135A possibly damaging Het
Tafa5 C T 15: 87,509,637 (GRCm39) probably benign Het
Trim58 G A 11: 58,542,150 (GRCm39) G370E probably damaging Het
Tshz2 T A 2: 169,728,167 (GRCm39) I452N probably damaging Het
Ttc41 C T 10: 86,566,989 (GRCm39) R552C probably benign Het
Vit T C 17: 78,909,308 (GRCm39) S252P probably benign Het
Vmn1r173 A T 7: 23,402,361 (GRCm39) I199F probably damaging Het
Vmn2r114 T A 17: 23,529,336 (GRCm39) R255S probably benign Het
Vmn2r17 A G 5: 109,582,246 (GRCm39) N545S probably damaging Het
Zbtb44 T G 9: 30,964,701 (GRCm39) V37G probably damaging Het
Zfp865 A G 7: 5,034,640 (GRCm39) Y875C probably damaging Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16,813,020 (GRCm39) missense probably damaging 1.00
IGL01529:Egfr APN 11 16,813,014 (GRCm39) missense probably benign
IGL01556:Egfr APN 11 16,855,382 (GRCm39) missense probably damaging 1.00
IGL02627:Egfr APN 11 16,819,346 (GRCm39) missense probably damaging 1.00
IGL02862:Egfr APN 11 16,833,562 (GRCm39) missense probably benign 0.25
IGL02945:Egfr APN 11 16,702,514 (GRCm39) missense probably damaging 1.00
IGL02994:Egfr APN 11 16,861,811 (GRCm39) missense probably damaging 1.00
IGL03395:Egfr APN 11 16,860,261 (GRCm39) splice site probably benign
set UTSW 11 16,821,881 (GRCm39) splice site probably benign
Velvet UTSW 11 16,854,399 (GRCm39) missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16,860,214 (GRCm39) missense probably benign 0.00
R0196:Egfr UTSW 11 16,861,746 (GRCm39) missense probably benign 0.02
R0513:Egfr UTSW 11 16,822,855 (GRCm39) missense probably damaging 1.00
R0567:Egfr UTSW 11 16,822,873 (GRCm39) missense probably benign 0.01
R0629:Egfr UTSW 11 16,819,333 (GRCm39) missense probably damaging 1.00
R0961:Egfr UTSW 11 16,812,964 (GRCm39) missense probably damaging 1.00
R1163:Egfr UTSW 11 16,833,546 (GRCm39) missense probably benign 0.02
R1454:Egfr UTSW 11 16,839,920 (GRCm39) missense probably benign
R1456:Egfr UTSW 11 16,813,065 (GRCm39) missense probably benign 0.00
R1503:Egfr UTSW 11 16,819,301 (GRCm39) missense possibly damaging 0.86
R1577:Egfr UTSW 11 16,819,241 (GRCm39) missense probably benign 0.04
R1595:Egfr UTSW 11 16,856,847 (GRCm39) missense probably damaging 0.99
R1699:Egfr UTSW 11 16,809,019 (GRCm39) missense probably benign 0.14
R2172:Egfr UTSW 11 16,861,562 (GRCm39) missense probably benign 0.00
R3690:Egfr UTSW 11 16,821,881 (GRCm39) splice site probably benign
R3922:Egfr UTSW 11 16,831,495 (GRCm39) missense probably damaging 1.00
R4444:Egfr UTSW 11 16,821,027 (GRCm39) missense probably benign 0.00
R4685:Egfr UTSW 11 16,808,980 (GRCm39) missense probably damaging 1.00
R4737:Egfr UTSW 11 16,819,231 (GRCm39) missense probably damaging 0.99
R4814:Egfr UTSW 11 16,819,354 (GRCm39) missense probably damaging 1.00
R4842:Egfr UTSW 11 16,861,607 (GRCm39) missense probably benign 0.05
R4903:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4964:Egfr UTSW 11 16,858,949 (GRCm39) missense probably damaging 1.00
R4985:Egfr UTSW 11 16,809,029 (GRCm39) nonsense probably null
R4998:Egfr UTSW 11 16,831,493 (GRCm39) missense possibly damaging 0.58
R5001:Egfr UTSW 11 16,854,434 (GRCm39) missense probably damaging 0.98
R5304:Egfr UTSW 11 16,834,260 (GRCm39) missense probably benign
R5309:Egfr UTSW 11 16,861,703 (GRCm39) missense probably benign 0.00
R5653:Egfr UTSW 11 16,861,617 (GRCm39) missense probably benign 0.04
R5905:Egfr UTSW 11 16,861,494 (GRCm39) missense probably damaging 1.00
R6051:Egfr UTSW 11 16,833,607 (GRCm39) missense possibly damaging 0.87
R6052:Egfr UTSW 11 16,861,554 (GRCm39) missense probably benign 0.16
R6114:Egfr UTSW 11 16,854,374 (GRCm39) missense possibly damaging 0.46
R6261:Egfr UTSW 11 16,839,964 (GRCm39) missense probably benign 0.11
R6434:Egfr UTSW 11 16,819,294 (GRCm39) missense probably benign 0.25
R6475:Egfr UTSW 11 16,841,259 (GRCm39) missense probably benign
R6799:Egfr UTSW 11 16,846,952 (GRCm39) missense probably damaging 1.00
R7143:Egfr UTSW 11 16,821,627 (GRCm39) missense probably benign 0.20
R7195:Egfr UTSW 11 16,818,162 (GRCm39) missense probably damaging 1.00
R7459:Egfr UTSW 11 16,846,967 (GRCm39) missense probably damaging 1.00
R7612:Egfr UTSW 11 16,809,025 (GRCm39) missense possibly damaging 0.74
R7757:Egfr UTSW 11 16,839,966 (GRCm39) missense possibly damaging 0.64
R7763:Egfr UTSW 11 16,841,266 (GRCm39) missense probably damaging 1.00
R8315:Egfr UTSW 11 16,825,027 (GRCm39) missense probably benign 0.08
R8320:Egfr UTSW 11 16,841,251 (GRCm39) missense probably damaging 1.00
R8324:Egfr UTSW 11 16,858,885 (GRCm39) missense probably damaging 0.98
R8324:Egfr UTSW 11 16,808,971 (GRCm39) missense probably damaging 0.99
R8347:Egfr UTSW 11 16,828,174 (GRCm39) missense probably damaging 1.00
R8440:Egfr UTSW 11 16,859,831 (GRCm39) missense probably damaging 1.00
R8511:Egfr UTSW 11 16,846,949 (GRCm39) missense probably damaging 1.00
R8708:Egfr UTSW 11 16,817,300 (GRCm39) critical splice donor site probably benign
R8804:Egfr UTSW 11 16,819,339 (GRCm39) missense probably benign 0.09
R8853:Egfr UTSW 11 16,858,885 (GRCm39) missense possibly damaging 0.93
R8906:Egfr UTSW 11 16,861,635 (GRCm39) missense probably damaging 1.00
R9177:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9268:Egfr UTSW 11 16,855,410 (GRCm39) missense probably damaging 1.00
R9335:Egfr UTSW 11 16,820,991 (GRCm39) missense probably damaging 1.00
R9417:Egfr UTSW 11 16,825,067 (GRCm39) nonsense probably null
R9454:Egfr UTSW 11 16,837,155 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,819,319 (GRCm39) missense probably damaging 1.00
Z1177:Egfr UTSW 11 16,812,954 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGCTGAGGACACTTGCAGG -3'
(R):5'- GGGGCCCTTAAATATGCCATTTG -3'

Sequencing Primer
(F):5'- CACGGAATTCTGCATCAGGATCTTG -3'
(R):5'- CCATTTGGCTTGGTTTCCTTG -3'
Posted On 2016-03-01