Incidental Mutation 'R4841:Scube3'
ID371869
Institutional Source Beutler Lab
Gene Symbol Scube3
Ensembl Gene ENSMUSG00000038677
Gene Namesignal peptide, CUB domain, EGF-like 3
Synonyms
MMRRC Submission 042454-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R4841 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28142316-28174852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28164123 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 425 (C425Y)
Ref Sequence ENSEMBL: ENSMUSP00000038366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043503]
Predicted Effect probably damaging
Transcript: ENSMUST00000043503
AA Change: C425Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038366
Gene: ENSMUSG00000038677
AA Change: C425Y

DomainStartEndE-ValueType
low complexity region 9 15 N/A INTRINSIC
EGF_CA 29 69 5.23e-9 SMART
EGF_CA 70 111 1.2e-8 SMART
EGF_CA 112 152 1.14e-9 SMART
EGF 160 198 6.65e-2 SMART
EGF 200 237 7.95e0 SMART
EGF 239 276 7.76e-3 SMART
EGF_CA 277 317 7.63e-11 SMART
EGF_CA 318 356 7.01e-10 SMART
EGF_CA 357 398 6.8e-8 SMART
Pfam:GCC2_GCC3 642 689 8.6e-15 PFAM
Pfam:GCC2_GCC3 696 743 4.2e-17 PFAM
Pfam:GCC2_GCC3 752 799 5.8e-17 PFAM
CUB 804 916 1.09e-16 SMART
Blast:CUB 942 988 8e-15 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000132670
AA Change: C341Y
SMART Domains Protein: ENSMUSP00000117490
Gene: ENSMUSG00000038677
AA Change: C341Y

DomainStartEndE-ValueType
EGF_like 1 28 1.2e-1 SMART
EGF_CA 29 69 1.14e-9 SMART
EGF 77 115 6.65e-2 SMART
EGF 117 154 7.95e0 SMART
EGF 156 193 7.76e-3 SMART
EGF_CA 194 234 7.63e-11 SMART
EGF_CA 235 273 7.01e-10 SMART
EGF_CA 274 315 6.8e-8 SMART
Pfam:GCC2_GCC3 559 606 1.8e-17 PFAM
Pfam:GCC2_GCC3 615 662 4.2e-17 PFAM
CUB 667 779 1.09e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148342
Meta Mutation Damage Score 0.8611 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal peptide, complement subcomponents C1r/C1s, Uegf, bone morphogenetic protein-1 and epidermal growth factor-like domain containing protein family. Overexpression of this gene in human embryonic kidney cells results in secretion of a glycosylated form of the protein that forms oligomers and tethers to the cell surface. This gene is upregulated in lung cancer tumor tissue compared to healthy tissue and is associated with loss of the epithelial marker E-cadherin and with increased expression of vimentin, a mesenchymal marker. In addition, the protein encoded by this gene is a transforming growth factor beta receptor ligand, and when secreted by cancer cells, it can be cleaved in vitro to release the N-terminal epidermal growth factor-like repeat domain and the C-terminal complement subcomponents C1r/C1s domain. Both the full length protein and C-terminal fragment can bind to the transforming growth factor beta type II receptor to promote the epithelial-mesenchymal transition and tumor angiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted allele encoding a truncated protein exhibit normal morphology. Mice with a point mutation show skeletal abnormalities, bone metabolism alterations, changes in renal function, behavioral alternations and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4933427I04Rik T A 4: 123,860,377 M28K probably benign Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
A2m A T 6: 121,646,844 I390F probably benign Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamts6 A G 13: 104,312,787 D39G probably benign Het
Adgrl3 T C 5: 81,794,271 S1326P possibly damaging Het
Adgrv1 A G 13: 81,503,001 probably null Het
Ap3b2 G A 7: 81,477,930 A166V probably damaging Het
Bbox1 T A 2: 110,303,739 probably null Het
BC067074 G A 13: 113,366,190 G143D probably benign Het
Bckdk A G 7: 127,905,461 probably null Het
Cand1 C A 10: 119,213,546 probably null Het
Capn5 T C 7: 98,131,672 probably null Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Cnmd A G 14: 79,650,322 I153T possibly damaging Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dmrt2 G A 19: 25,677,667 G210D probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Dspp A T 5: 104,177,186 S472C unknown Het
Dspp G T 5: 104,177,187 S472I unknown Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fam19a5 C T 15: 87,625,436 probably benign Het
Fancd2 T C 6: 113,562,430 S239P probably damaging Het
Fbp2 C A 13: 62,854,913 Q108H probably benign Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Gpat2 C G 2: 127,433,967 T555S probably benign Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kat8 A G 7: 127,925,194 I415V probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lrguk T C 6: 34,092,867 V559A probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Olfr1301 C G 2: 111,754,334 F28L probably benign Het
Olfr291 G T 7: 84,857,120 L250F probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Osbpl3 T A 6: 50,309,376 N623I probably damaging Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pex16 T G 2: 92,379,199 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Rreb1 G A 13: 37,916,526 C211Y probably benign Het
Rundc3b A G 5: 8,528,742 L222P probably damaging Het
Ryr3 T C 2: 112,648,373 N4405S probably damaging Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Slc4a10 T C 2: 62,257,595 V414A possibly damaging Het
Slc9a3 G T 13: 74,165,837 D755Y probably damaging Het
Snrpb2 C A 2: 143,068,317 F98L possibly damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Tshz2 T A 2: 169,886,247 I452N probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zbtb44 T G 9: 31,053,405 V37G probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Scube3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Scube3 APN 17 28167684 missense probably damaging 1.00
IGL02189:Scube3 APN 17 28162996 missense probably benign
IGL02416:Scube3 APN 17 28164136 missense probably damaging 1.00
IGL02904:Scube3 APN 17 28167600 missense probably benign 0.01
IGL03153:Scube3 APN 17 28167058 missense possibly damaging 0.54
IGL03309:Scube3 APN 17 28164357 nonsense probably null
dinklage UTSW 17 28162388 missense probably damaging 1.00
R0027:Scube3 UTSW 17 28164357 nonsense probably null
R0084:Scube3 UTSW 17 28162961 missense probably benign 0.12
R0122:Scube3 UTSW 17 28166528 splice site probably benign
R0544:Scube3 UTSW 17 28164153 missense probably damaging 1.00
R1779:Scube3 UTSW 17 28168379 splice site probably benign
R1842:Scube3 UTSW 17 28165089 missense probably damaging 1.00
R1878:Scube3 UTSW 17 28152413 missense probably benign 0.10
R1950:Scube3 UTSW 17 28164300 missense possibly damaging 0.66
R2011:Scube3 UTSW 17 28168158 missense probably damaging 0.99
R2164:Scube3 UTSW 17 28166134 missense possibly damaging 0.64
R4356:Scube3 UTSW 17 28164309 missense probably benign 0.01
R4392:Scube3 UTSW 17 28164788 missense probably null
R4528:Scube3 UTSW 17 28162999 missense possibly damaging 0.82
R4709:Scube3 UTSW 17 28167192 splice site probably null
R4809:Scube3 UTSW 17 28165173 missense probably damaging 1.00
R4832:Scube3 UTSW 17 28166015 missense probably damaging 0.98
R4842:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R5372:Scube3 UTSW 17 28152482 missense probably damaging 0.99
R5889:Scube3 UTSW 17 28160913 missense possibly damaging 0.84
R5936:Scube3 UTSW 17 28165487 missense probably damaging 1.00
R6523:Scube3 UTSW 17 28162388 missense probably damaging 1.00
R7051:Scube3 UTSW 17 28167599 missense probably benign
R7337:Scube3 UTSW 17 28168182 missense probably damaging 1.00
R7699:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7700:Scube3 UTSW 17 28167049 missense probably damaging 1.00
R7848:Scube3 UTSW 17 28165595 missense probably benign
R7950:Scube3 UTSW 17 28171226 missense probably benign 0.11
RF009:Scube3 UTSW 17 28168397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATGCTGTTTCAGGGGAAG -3'
(R):5'- AAGAAGGGGCTTATCACAGC -3'

Sequencing Primer
(F):5'- CAGGTCTCCTTGGGCATGTAAC -3'
(R):5'- GGGCTTATCACAGCTCTGAC -3'
Posted On2016-03-01