Incidental Mutation 'R4842:Pnpla7'
ID 371882
Institutional Source Beutler Lab
Gene Symbol Pnpla7
Ensembl Gene ENSMUSG00000036833
Gene Name patatin-like phospholipase domain containing 7
Synonyms NRE, E430013P11Rik
MMRRC Submission 042455-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.157) question?
Stock # R4842 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 24866045-24944069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24870064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 15 (T15A)
Ref Sequence ENSEMBL: ENSMUSP00000117428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045295] [ENSMUST00000045604] [ENSMUST00000137913] [ENSMUST00000153618] [ENSMUST00000152777]
AlphaFold A2AJ88
Predicted Effect probably benign
Transcript: ENSMUST00000045295
AA Change: T17A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833
AA Change: T17A

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045604
SMART Domains Protein: ENSMUSP00000043561
Gene: ENSMUSG00000036850

DomainStartEndE-ValueType
Pfam:MRP-L27 13 125 1.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142139
Predicted Effect probably benign
Transcript: ENSMUST00000153618
AA Change: T15A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117428
Gene: ENSMUSG00000036833
AA Change: T15A

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152777
SMART Domains Protein: ENSMUSP00000122394
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
cNMP 89 179 4.98e0 SMART
Meta Mutation Damage Score 0.0675 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human patatin-like phospholipases, such as PNPLA7, have been implicated in regulation of adipocyte differentiation and have been induced by metabolic stimuli (Wilson et al., 2006 [PubMed 16799181]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 15,164,001 (GRCm39) I43L possibly damaging Het
4930449A18Rik T A 3: 59,749,153 (GRCm39) noncoding transcript Het
Abcc8 T C 7: 45,800,252 (GRCm39) K510R probably damaging Het
Adamtsl3 C T 7: 82,178,069 (GRCm39) R511C probably damaging Het
Arhgap11a T C 2: 113,670,107 (GRCm39) S339G probably damaging Het
C2cd3 A G 7: 100,065,397 (GRCm39) T728A probably benign Het
Cand1 C A 10: 119,049,451 (GRCm39) probably null Het
Catspere1 A T 1: 177,699,624 (GRCm39) noncoding transcript Het
Ccdc121rt2 A T 5: 112,598,106 (GRCm39) K218* probably null Het
Cd209c G T 8: 3,995,905 (GRCm39) R2S probably benign Het
Cdc16 A G 8: 13,831,644 (GRCm39) probably benign Het
Ces1g C T 8: 94,060,323 (GRCm39) E99K probably benign Het
Chrna7 A C 7: 62,862,196 (GRCm39) L10R probably benign Het
Clnk C T 5: 38,870,412 (GRCm39) probably null Het
Cntrob C G 11: 69,206,220 (GRCm39) L315F possibly damaging Het
Ctdp1 A G 18: 80,451,941 (GRCm39) S145P unknown Het
Dennd2a T C 6: 39,474,044 (GRCm39) D430G probably damaging Het
Dnajc16 A G 4: 141,501,936 (GRCm39) F298S probably damaging Het
Dock5 T C 14: 68,055,012 (GRCm39) D618G probably damaging Het
Drc3 G A 11: 60,261,361 (GRCm39) A171T probably benign Het
Ecel1 A T 1: 87,081,023 (GRCm39) N322K probably damaging Het
Eftud2 A G 11: 102,745,640 (GRCm39) F362L probably damaging Het
Egfr C T 11: 16,861,607 (GRCm39) H1129Y probably benign Het
Eif2b1 A G 5: 124,714,971 (GRCm39) S102P probably damaging Het
Erich3 T A 3: 154,410,480 (GRCm39) F112I possibly damaging Het
Fam107b T C 2: 3,779,580 (GRCm39) L261S probably damaging Het
Fat3 A C 9: 15,908,883 (GRCm39) V2373G probably damaging Het
Fcgbpl1 T A 7: 27,850,147 (GRCm39) C1198S probably damaging Het
Gadd45a A T 6: 67,013,873 (GRCm39) L58Q probably damaging Het
Gask1b G A 3: 79,843,912 (GRCm39) R377H probably damaging Het
Gipr C T 7: 18,896,601 (GRCm39) R165H probably damaging Het
Gje1 C T 10: 14,593,082 (GRCm39) G45R probably null Het
Gldc T A 19: 30,111,132 (GRCm39) N548I possibly damaging Het
Gm13035 A G 4: 146,009,993 (GRCm39) noncoding transcript Het
Gm27013 T A 6: 130,497,700 (GRCm39) noncoding transcript Het
Gm5436 A T 12: 84,305,584 (GRCm39) noncoding transcript Het
Grik3 C A 4: 125,584,969 (GRCm39) N612K probably damaging Het
H2bc13 C T 13: 21,900,234 (GRCm39) probably benign Het
Hfm1 C A 5: 107,040,617 (GRCm39) W716L probably damaging Het
Il5ra T C 6: 106,715,336 (GRCm39) Y166C probably damaging Het
Iqcb1 A G 16: 36,655,952 (GRCm39) E113G probably benign Het
Kcnk10 A T 12: 98,401,175 (GRCm39) M486K probably benign Het
Kcnv2 A G 19: 27,301,190 (GRCm39) D347G probably damaging Het
Kif21b C A 1: 136,072,958 (GRCm39) H119N probably damaging Het
Lamb1 C T 12: 31,337,432 (GRCm39) H388Y probably damaging Het
Leng9 T C 7: 4,152,385 (GRCm39) D97G probably damaging Het
Lmbr1 G A 5: 29,492,424 (GRCm39) T55I probably damaging Het
Lrp1 G T 10: 127,419,805 (GRCm39) R935S probably damaging Het
Lrp2 A T 2: 69,299,755 (GRCm39) V3099E probably benign Het
Lrrcc1 C A 3: 14,627,571 (GRCm39) D503E probably benign Het
Map1a T A 2: 121,132,567 (GRCm39) S890T probably damaging Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Mybph A T 1: 134,126,233 (GRCm39) E349V probably damaging Het
Myh7b C A 2: 155,475,909 (GRCm39) L1935M probably benign Het
Myh9 T C 15: 77,653,453 (GRCm39) E1348G probably damaging Het
Myzap A G 9: 71,456,037 (GRCm39) S328P probably damaging Het
Nbeal1 T C 1: 60,292,534 (GRCm39) L1062P probably damaging Het
Nepro G A 16: 44,555,160 (GRCm39) S412N probably null Het
Nr1h3 A G 2: 91,020,563 (GRCm39) F257L probably benign Het
Nudt5 T C 2: 5,869,239 (GRCm39) V155A probably benign Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or13a25 A T 7: 140,247,502 (GRCm39) I94F probably damaging Het
Or52d3 A T 7: 104,229,422 (GRCm39) I190L probably benign Het
Or6ae1 A G 7: 139,742,602 (GRCm39) L87P possibly damaging Het
Pde1a T A 2: 79,959,181 (GRCm39) probably benign Het
Pde4dip T A 3: 97,700,844 (GRCm39) H220L probably damaging Het
Pde9a T A 17: 31,662,135 (GRCm39) probably null Het
Pnkp C A 7: 44,511,070 (GRCm39) probably null Het
Polq G T 16: 36,869,145 (GRCm39) probably null Het
Ppfia2 C T 10: 106,690,818 (GRCm39) T553I probably benign Het
Ptk6 T G 2: 180,838,784 (GRCm39) N323T possibly damaging Het
Rhox3c G A X: 36,652,077 (GRCm39) A60T probably damaging Het
Rnf4 T A 5: 34,506,053 (GRCm39) V61E probably damaging Het
Rnf5 A G 17: 34,820,977 (GRCm39) probably benign Het
Sardh A G 2: 27,081,967 (GRCm39) V853A probably benign Het
Scfd1 T C 12: 51,436,109 (GRCm39) V86A probably damaging Het
Scube3 G A 17: 28,383,097 (GRCm39) C425Y probably damaging Het
Sema5a C T 15: 32,609,563 (GRCm39) H490Y probably benign Het
Sfta2 T C 17: 35,960,773 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,031,049 (GRCm39) Y738H probably damaging Het
Shc2 T C 10: 79,458,295 (GRCm39) R463G probably damaging Het
Socs7 T A 11: 97,267,829 (GRCm39) I320N possibly damaging Het
Speer2 A T 16: 69,654,988 (GRCm39) M159K probably benign Het
Sppl2c A C 11: 104,078,478 (GRCm39) H426P probably benign Het
Stag3 T G 5: 138,307,627 (GRCm39) probably null Het
Stxbp5 C A 10: 9,638,635 (GRCm39) V1055L probably benign Het
Synpo A T 18: 60,736,684 (GRCm39) S421T probably damaging Het
Taf6l A G 19: 8,759,770 (GRCm39) V135A possibly damaging Het
Tas2r116 G A 6: 132,832,660 (GRCm39) S87N probably benign Het
Tomm6 T C 17: 47,998,994 (GRCm39) probably benign Het
Trabd T C 15: 88,966,915 (GRCm39) M113T probably benign Het
Trim58 G A 11: 58,542,150 (GRCm39) G370E probably damaging Het
Ttc41 C T 10: 86,566,989 (GRCm39) R552C probably benign Het
Vit T C 17: 78,909,308 (GRCm39) S252P probably benign Het
Vma21-ps T A 4: 52,496,943 (GRCm39) D101V probably damaging Het
Vmn1r173 A T 7: 23,402,361 (GRCm39) I199F probably damaging Het
Vmn2r114 T A 17: 23,529,336 (GRCm39) R255S probably benign Het
Vmn2r17 A G 5: 109,582,246 (GRCm39) N545S probably damaging Het
Zfp865 A G 7: 5,034,640 (GRCm39) Y875C probably damaging Het
Other mutations in Pnpla7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pnpla7 APN 2 24,866,327 (GRCm39) critical splice donor site probably null
IGL00765:Pnpla7 APN 2 24,870,236 (GRCm39) missense probably damaging 0.98
IGL01576:Pnpla7 APN 2 24,906,575 (GRCm39) missense probably damaging 1.00
IGL01626:Pnpla7 APN 2 24,940,905 (GRCm39) missense possibly damaging 0.58
IGL01844:Pnpla7 APN 2 24,940,985 (GRCm39) critical splice donor site probably null
IGL02280:Pnpla7 APN 2 24,901,589 (GRCm39) missense probably benign 0.00
IGL02629:Pnpla7 APN 2 24,940,957 (GRCm39) missense probably damaging 1.00
IGL02642:Pnpla7 APN 2 24,940,288 (GRCm39) missense probably benign 0.24
IGL02931:Pnpla7 APN 2 24,905,241 (GRCm39) missense possibly damaging 0.87
IGL03162:Pnpla7 APN 2 24,905,301 (GRCm39) unclassified probably benign
PIT4495001:Pnpla7 UTSW 2 24,932,151 (GRCm39) missense probably damaging 0.99
R0047:Pnpla7 UTSW 2 24,901,618 (GRCm39) missense probably damaging 1.00
R0047:Pnpla7 UTSW 2 24,901,618 (GRCm39) missense probably damaging 1.00
R0064:Pnpla7 UTSW 2 24,887,239 (GRCm39) nonsense probably null
R0064:Pnpla7 UTSW 2 24,887,239 (GRCm39) nonsense probably null
R0309:Pnpla7 UTSW 2 24,877,207 (GRCm39) missense probably damaging 1.00
R0541:Pnpla7 UTSW 2 24,885,305 (GRCm39) missense probably damaging 0.99
R0556:Pnpla7 UTSW 2 24,942,313 (GRCm39) splice site probably null
R0565:Pnpla7 UTSW 2 24,870,129 (GRCm39) splice site probably benign
R0830:Pnpla7 UTSW 2 24,887,267 (GRCm39) missense probably damaging 1.00
R0865:Pnpla7 UTSW 2 24,872,135 (GRCm39) missense probably benign 0.34
R0893:Pnpla7 UTSW 2 24,887,252 (GRCm39) missense probably damaging 1.00
R0969:Pnpla7 UTSW 2 24,940,965 (GRCm39) missense probably damaging 1.00
R1102:Pnpla7 UTSW 2 24,886,177 (GRCm39) missense probably damaging 1.00
R1551:Pnpla7 UTSW 2 24,937,720 (GRCm39) missense probably benign 0.01
R1572:Pnpla7 UTSW 2 24,905,263 (GRCm39) missense possibly damaging 0.69
R1623:Pnpla7 UTSW 2 24,942,611 (GRCm39) missense probably damaging 1.00
R1876:Pnpla7 UTSW 2 24,930,985 (GRCm39) missense possibly damaging 0.91
R1898:Pnpla7 UTSW 2 24,943,796 (GRCm39) unclassified probably benign
R1909:Pnpla7 UTSW 2 24,887,300 (GRCm39) missense possibly damaging 0.75
R1973:Pnpla7 UTSW 2 24,906,629 (GRCm39) missense probably damaging 1.00
R2230:Pnpla7 UTSW 2 24,941,610 (GRCm39) unclassified probably benign
R2381:Pnpla7 UTSW 2 24,870,770 (GRCm39) missense probably damaging 1.00
R2655:Pnpla7 UTSW 2 24,942,330 (GRCm39) missense probably damaging 1.00
R3125:Pnpla7 UTSW 2 24,932,150 (GRCm39) missense probably damaging 1.00
R4223:Pnpla7 UTSW 2 24,872,126 (GRCm39) missense possibly damaging 0.69
R4411:Pnpla7 UTSW 2 24,941,716 (GRCm39) nonsense probably null
R4573:Pnpla7 UTSW 2 24,940,885 (GRCm39) missense probably damaging 0.98
R4674:Pnpla7 UTSW 2 24,942,329 (GRCm39) missense probably damaging 1.00
R4841:Pnpla7 UTSW 2 24,870,064 (GRCm39) missense probably benign 0.05
R4893:Pnpla7 UTSW 2 24,943,688 (GRCm39) nonsense probably null
R4941:Pnpla7 UTSW 2 24,887,276 (GRCm39) splice site probably null
R5116:Pnpla7 UTSW 2 24,911,982 (GRCm39) missense probably damaging 0.97
R5126:Pnpla7 UTSW 2 24,870,056 (GRCm39) missense possibly damaging 0.83
R5138:Pnpla7 UTSW 2 24,931,115 (GRCm39) missense possibly damaging 0.88
R5169:Pnpla7 UTSW 2 24,940,321 (GRCm39) missense probably benign 0.03
R5188:Pnpla7 UTSW 2 24,887,312 (GRCm39) missense probably benign 0.06
R5288:Pnpla7 UTSW 2 24,931,031 (GRCm39) missense probably damaging 0.97
R5307:Pnpla7 UTSW 2 24,911,964 (GRCm39) missense possibly damaging 0.81
R5339:Pnpla7 UTSW 2 24,892,949 (GRCm39) missense probably benign 0.10
R5384:Pnpla7 UTSW 2 24,931,031 (GRCm39) missense probably damaging 0.97
R5385:Pnpla7 UTSW 2 24,931,031 (GRCm39) missense probably damaging 0.97
R5479:Pnpla7 UTSW 2 24,909,453 (GRCm39) missense possibly damaging 0.90
R5640:Pnpla7 UTSW 2 24,893,013 (GRCm39) missense possibly damaging 0.92
R5662:Pnpla7 UTSW 2 24,942,396 (GRCm39) missense probably damaging 1.00
R5751:Pnpla7 UTSW 2 24,871,790 (GRCm39) missense probably damaging 0.97
R5874:Pnpla7 UTSW 2 24,901,661 (GRCm39) missense probably benign
R6284:Pnpla7 UTSW 2 24,906,630 (GRCm39) missense possibly damaging 0.79
R6351:Pnpla7 UTSW 2 24,901,576 (GRCm39) missense probably damaging 0.97
R6513:Pnpla7 UTSW 2 24,906,550 (GRCm39) missense possibly damaging 0.62
R7193:Pnpla7 UTSW 2 24,941,627 (GRCm39) missense probably damaging 1.00
R7503:Pnpla7 UTSW 2 24,873,544 (GRCm39) nonsense probably null
R7526:Pnpla7 UTSW 2 24,888,678 (GRCm39) missense possibly damaging 0.52
R7791:Pnpla7 UTSW 2 24,942,078 (GRCm39) missense probably damaging 1.00
R8262:Pnpla7 UTSW 2 24,873,635 (GRCm39) missense probably damaging 1.00
R8283:Pnpla7 UTSW 2 24,940,935 (GRCm39) missense probably damaging 1.00
R8993:Pnpla7 UTSW 2 24,943,431 (GRCm39) missense possibly damaging 0.68
R9086:Pnpla7 UTSW 2 24,929,709 (GRCm39) missense probably damaging 1.00
R9229:Pnpla7 UTSW 2 24,873,503 (GRCm39) missense probably damaging 0.98
R9494:Pnpla7 UTSW 2 24,942,390 (GRCm39) nonsense probably null
R9651:Pnpla7 UTSW 2 24,892,931 (GRCm39) missense probably benign 0.02
Z1177:Pnpla7 UTSW 2 24,888,771 (GRCm39) missense probably null 0.06
Predicted Primers PCR Primer
(F):5'- TGTGTAACTTTGAGAAGGTAATAGC -3'
(R):5'- AGGGCGCCAATTCCAATCC -3'

Sequencing Primer
(F):5'- GATAACACTCAGGTCCTCAGGCTTG -3'
(R):5'- CCCATCAGCTACACAGGATGG -3'
Posted On 2016-03-01