Incidental Mutation 'R4842:Sardh'
ID 371883
Institutional Source Beutler Lab
Gene Symbol Sardh
Ensembl Gene ENSMUSG00000009614
Gene Name sarcosine dehydrogenase
Synonyms
MMRRC Submission 042455-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R4842 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 27078405-27138344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27081967 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 853 (V853A)
Ref Sequence ENSEMBL: ENSMUSP00000099950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102886]
AlphaFold Q99LB7
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091224
Predicted Effect probably benign
Transcript: ENSMUST00000102886
AA Change: V853A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099950
Gene: ENSMUSG00000009614
AA Change: V853A

DomainStartEndE-ValueType
Pfam:DAO 69 428 1.7e-63 PFAM
Pfam:FAO_M 431 486 9.2e-22 PFAM
Pfam:GCV_T 489 799 3.1e-64 PFAM
Pfam:GCV_T_C 807 904 4.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170435
Meta Mutation Damage Score 0.3662 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme localized to the mitochondrial matrix which catalyzes the oxidative demethylation of sarcosine. This enzyme is distinct from another mitochondrial matrix enzyme, dimethylglycine dehydrogenase, which catalyzes a reaction resulting in the formation of sarcosine. Mutations in this gene are associated with sarcosinemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 15,164,001 (GRCm39) I43L possibly damaging Het
4930449A18Rik T A 3: 59,749,153 (GRCm39) noncoding transcript Het
Abcc8 T C 7: 45,800,252 (GRCm39) K510R probably damaging Het
Adamtsl3 C T 7: 82,178,069 (GRCm39) R511C probably damaging Het
Arhgap11a T C 2: 113,670,107 (GRCm39) S339G probably damaging Het
C2cd3 A G 7: 100,065,397 (GRCm39) T728A probably benign Het
Cand1 C A 10: 119,049,451 (GRCm39) probably null Het
Catspere1 A T 1: 177,699,624 (GRCm39) noncoding transcript Het
Ccdc121rt2 A T 5: 112,598,106 (GRCm39) K218* probably null Het
Cd209c G T 8: 3,995,905 (GRCm39) R2S probably benign Het
Cdc16 A G 8: 13,831,644 (GRCm39) probably benign Het
Ces1g C T 8: 94,060,323 (GRCm39) E99K probably benign Het
Chrna7 A C 7: 62,862,196 (GRCm39) L10R probably benign Het
Clnk C T 5: 38,870,412 (GRCm39) probably null Het
Cntrob C G 11: 69,206,220 (GRCm39) L315F possibly damaging Het
Ctdp1 A G 18: 80,451,941 (GRCm39) S145P unknown Het
Dennd2a T C 6: 39,474,044 (GRCm39) D430G probably damaging Het
Dnajc16 A G 4: 141,501,936 (GRCm39) F298S probably damaging Het
Dock5 T C 14: 68,055,012 (GRCm39) D618G probably damaging Het
Drc3 G A 11: 60,261,361 (GRCm39) A171T probably benign Het
Ecel1 A T 1: 87,081,023 (GRCm39) N322K probably damaging Het
Eftud2 A G 11: 102,745,640 (GRCm39) F362L probably damaging Het
Egfr C T 11: 16,861,607 (GRCm39) H1129Y probably benign Het
Eif2b1 A G 5: 124,714,971 (GRCm39) S102P probably damaging Het
Erich3 T A 3: 154,410,480 (GRCm39) F112I possibly damaging Het
Fam107b T C 2: 3,779,580 (GRCm39) L261S probably damaging Het
Fat3 A C 9: 15,908,883 (GRCm39) V2373G probably damaging Het
Fcgbpl1 T A 7: 27,850,147 (GRCm39) C1198S probably damaging Het
Gadd45a A T 6: 67,013,873 (GRCm39) L58Q probably damaging Het
Gask1b G A 3: 79,843,912 (GRCm39) R377H probably damaging Het
Gipr C T 7: 18,896,601 (GRCm39) R165H probably damaging Het
Gje1 C T 10: 14,593,082 (GRCm39) G45R probably null Het
Gldc T A 19: 30,111,132 (GRCm39) N548I possibly damaging Het
Gm13035 A G 4: 146,009,993 (GRCm39) noncoding transcript Het
Gm27013 T A 6: 130,497,700 (GRCm39) noncoding transcript Het
Gm5436 A T 12: 84,305,584 (GRCm39) noncoding transcript Het
Grik3 C A 4: 125,584,969 (GRCm39) N612K probably damaging Het
H2bc13 C T 13: 21,900,234 (GRCm39) probably benign Het
Hfm1 C A 5: 107,040,617 (GRCm39) W716L probably damaging Het
Il5ra T C 6: 106,715,336 (GRCm39) Y166C probably damaging Het
Iqcb1 A G 16: 36,655,952 (GRCm39) E113G probably benign Het
Kcnk10 A T 12: 98,401,175 (GRCm39) M486K probably benign Het
Kcnv2 A G 19: 27,301,190 (GRCm39) D347G probably damaging Het
Kif21b C A 1: 136,072,958 (GRCm39) H119N probably damaging Het
Lamb1 C T 12: 31,337,432 (GRCm39) H388Y probably damaging Het
Leng9 T C 7: 4,152,385 (GRCm39) D97G probably damaging Het
Lmbr1 G A 5: 29,492,424 (GRCm39) T55I probably damaging Het
Lrp1 G T 10: 127,419,805 (GRCm39) R935S probably damaging Het
Lrp2 A T 2: 69,299,755 (GRCm39) V3099E probably benign Het
Lrrcc1 C A 3: 14,627,571 (GRCm39) D503E probably benign Het
Map1a T A 2: 121,132,567 (GRCm39) S890T probably damaging Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Mybph A T 1: 134,126,233 (GRCm39) E349V probably damaging Het
Myh7b C A 2: 155,475,909 (GRCm39) L1935M probably benign Het
Myh9 T C 15: 77,653,453 (GRCm39) E1348G probably damaging Het
Myzap A G 9: 71,456,037 (GRCm39) S328P probably damaging Het
Nbeal1 T C 1: 60,292,534 (GRCm39) L1062P probably damaging Het
Nepro G A 16: 44,555,160 (GRCm39) S412N probably null Het
Nr1h3 A G 2: 91,020,563 (GRCm39) F257L probably benign Het
Nudt5 T C 2: 5,869,239 (GRCm39) V155A probably benign Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or13a25 A T 7: 140,247,502 (GRCm39) I94F probably damaging Het
Or52d3 A T 7: 104,229,422 (GRCm39) I190L probably benign Het
Or6ae1 A G 7: 139,742,602 (GRCm39) L87P possibly damaging Het
Pde1a T A 2: 79,959,181 (GRCm39) probably benign Het
Pde4dip T A 3: 97,700,844 (GRCm39) H220L probably damaging Het
Pde9a T A 17: 31,662,135 (GRCm39) probably null Het
Pnkp C A 7: 44,511,070 (GRCm39) probably null Het
Pnpla7 A G 2: 24,870,064 (GRCm39) T15A probably benign Het
Polq G T 16: 36,869,145 (GRCm39) probably null Het
Ppfia2 C T 10: 106,690,818 (GRCm39) T553I probably benign Het
Ptk6 T G 2: 180,838,784 (GRCm39) N323T possibly damaging Het
Rhox3c G A X: 36,652,077 (GRCm39) A60T probably damaging Het
Rnf4 T A 5: 34,506,053 (GRCm39) V61E probably damaging Het
Rnf5 A G 17: 34,820,977 (GRCm39) probably benign Het
Scfd1 T C 12: 51,436,109 (GRCm39) V86A probably damaging Het
Scube3 G A 17: 28,383,097 (GRCm39) C425Y probably damaging Het
Sema5a C T 15: 32,609,563 (GRCm39) H490Y probably benign Het
Sfta2 T C 17: 35,960,773 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,031,049 (GRCm39) Y738H probably damaging Het
Shc2 T C 10: 79,458,295 (GRCm39) R463G probably damaging Het
Socs7 T A 11: 97,267,829 (GRCm39) I320N possibly damaging Het
Speer2 A T 16: 69,654,988 (GRCm39) M159K probably benign Het
Sppl2c A C 11: 104,078,478 (GRCm39) H426P probably benign Het
Stag3 T G 5: 138,307,627 (GRCm39) probably null Het
Stxbp5 C A 10: 9,638,635 (GRCm39) V1055L probably benign Het
Synpo A T 18: 60,736,684 (GRCm39) S421T probably damaging Het
Taf6l A G 19: 8,759,770 (GRCm39) V135A possibly damaging Het
Tas2r116 G A 6: 132,832,660 (GRCm39) S87N probably benign Het
Tomm6 T C 17: 47,998,994 (GRCm39) probably benign Het
Trabd T C 15: 88,966,915 (GRCm39) M113T probably benign Het
Trim58 G A 11: 58,542,150 (GRCm39) G370E probably damaging Het
Ttc41 C T 10: 86,566,989 (GRCm39) R552C probably benign Het
Vit T C 17: 78,909,308 (GRCm39) S252P probably benign Het
Vma21-ps T A 4: 52,496,943 (GRCm39) D101V probably damaging Het
Vmn1r173 A T 7: 23,402,361 (GRCm39) I199F probably damaging Het
Vmn2r114 T A 17: 23,529,336 (GRCm39) R255S probably benign Het
Vmn2r17 A G 5: 109,582,246 (GRCm39) N545S probably damaging Het
Zfp865 A G 7: 5,034,640 (GRCm39) Y875C probably damaging Het
Other mutations in Sardh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Sardh APN 2 27,105,125 (GRCm39) missense probably benign 0.07
IGL01686:Sardh APN 2 27,079,625 (GRCm39) missense probably damaging 1.00
IGL01868:Sardh APN 2 27,117,159 (GRCm39) missense probably benign 0.35
IGL02167:Sardh APN 2 27,081,987 (GRCm39) missense probably damaging 0.98
IGL02272:Sardh APN 2 27,115,003 (GRCm39) missense probably benign 0.00
IGL02870:Sardh APN 2 27,125,503 (GRCm39) missense possibly damaging 0.93
IGL03117:Sardh APN 2 27,129,458 (GRCm39) missense probably damaging 1.00
PIT4305001:Sardh UTSW 2 27,118,326 (GRCm39) missense probably damaging 1.00
PIT4791001:Sardh UTSW 2 27,087,660 (GRCm39) missense probably damaging 1.00
R0265:Sardh UTSW 2 27,117,078 (GRCm39) splice site probably benign
R0781:Sardh UTSW 2 27,081,931 (GRCm39) missense possibly damaging 0.82
R1110:Sardh UTSW 2 27,081,931 (GRCm39) missense possibly damaging 0.82
R1242:Sardh UTSW 2 27,125,575 (GRCm39) missense probably damaging 1.00
R1404:Sardh UTSW 2 27,129,473 (GRCm39) missense probably damaging 1.00
R1404:Sardh UTSW 2 27,129,473 (GRCm39) missense probably damaging 1.00
R1514:Sardh UTSW 2 27,087,702 (GRCm39) missense possibly damaging 0.95
R1565:Sardh UTSW 2 27,132,731 (GRCm39) missense probably damaging 1.00
R1832:Sardh UTSW 2 27,125,581 (GRCm39) missense possibly damaging 0.95
R1836:Sardh UTSW 2 27,105,194 (GRCm39) missense possibly damaging 0.65
R1997:Sardh UTSW 2 27,134,409 (GRCm39) missense probably damaging 0.97
R2006:Sardh UTSW 2 27,118,351 (GRCm39) missense probably damaging 1.00
R2046:Sardh UTSW 2 27,105,094 (GRCm39) missense possibly damaging 0.95
R2242:Sardh UTSW 2 27,125,527 (GRCm39) missense possibly damaging 0.93
R2897:Sardh UTSW 2 27,079,559 (GRCm39) missense probably benign 0.00
R4332:Sardh UTSW 2 27,105,126 (GRCm39) missense possibly damaging 0.85
R4807:Sardh UTSW 2 27,079,539 (GRCm39) missense probably benign 0.00
R4841:Sardh UTSW 2 27,081,967 (GRCm39) missense probably benign 0.09
R4856:Sardh UTSW 2 27,134,489 (GRCm39) missense probably benign 0.02
R4936:Sardh UTSW 2 27,118,253 (GRCm39) splice site probably null
R5089:Sardh UTSW 2 27,129,625 (GRCm39) critical splice donor site probably null
R5110:Sardh UTSW 2 27,079,559 (GRCm39) missense probably benign 0.00
R5257:Sardh UTSW 2 27,134,271 (GRCm39) missense probably damaging 0.98
R5406:Sardh UTSW 2 27,101,096 (GRCm39) missense possibly damaging 0.72
R5450:Sardh UTSW 2 27,129,710 (GRCm39) missense possibly damaging 0.65
R5594:Sardh UTSW 2 27,110,735 (GRCm39) missense probably damaging 1.00
R5870:Sardh UTSW 2 27,110,653 (GRCm39) critical splice donor site probably null
R6014:Sardh UTSW 2 27,087,540 (GRCm39) critical splice donor site probably null
R6021:Sardh UTSW 2 27,079,655 (GRCm39) missense probably benign 0.44
R6470:Sardh UTSW 2 27,134,384 (GRCm39) missense probably damaging 1.00
R6577:Sardh UTSW 2 27,108,867 (GRCm39) missense possibly damaging 0.95
R6750:Sardh UTSW 2 27,118,269 (GRCm39) missense probably benign 0.04
R7035:Sardh UTSW 2 27,120,854 (GRCm39) missense probably damaging 1.00
R7162:Sardh UTSW 2 27,087,702 (GRCm39) missense possibly damaging 0.95
R7256:Sardh UTSW 2 27,108,824 (GRCm39) missense probably benign
R7692:Sardh UTSW 2 27,087,651 (GRCm39) missense probably benign 0.01
R7709:Sardh UTSW 2 27,131,529 (GRCm39) missense possibly damaging 0.62
R7884:Sardh UTSW 2 27,129,383 (GRCm39) missense probably damaging 0.99
R8028:Sardh UTSW 2 27,120,467 (GRCm39) missense probably damaging 1.00
R8095:Sardh UTSW 2 27,132,730 (GRCm39) missense probably damaging 1.00
R8120:Sardh UTSW 2 27,108,863 (GRCm39) missense possibly damaging 0.62
R8302:Sardh UTSW 2 27,105,122 (GRCm39) missense probably benign 0.03
R8323:Sardh UTSW 2 27,125,576 (GRCm39) missense probably damaging 1.00
R8535:Sardh UTSW 2 27,129,657 (GRCm39) missense probably damaging 1.00
R8704:Sardh UTSW 2 27,120,477 (GRCm39) missense possibly damaging 0.50
R8781:Sardh UTSW 2 27,086,715 (GRCm39) missense possibly damaging 0.95
R8858:Sardh UTSW 2 27,118,302 (GRCm39) missense probably null 1.00
R9265:Sardh UTSW 2 27,105,065 (GRCm39) missense probably damaging 0.99
R9337:Sardh UTSW 2 27,086,678 (GRCm39) missense probably benign 0.11
R9342:Sardh UTSW 2 27,120,869 (GRCm39) missense possibly damaging 0.95
R9539:Sardh UTSW 2 27,134,298 (GRCm39) missense probably damaging 0.99
R9600:Sardh UTSW 2 27,120,513 (GRCm39) missense probably benign
R9714:Sardh UTSW 2 27,079,641 (GRCm39) missense possibly damaging 0.64
X0011:Sardh UTSW 2 27,132,758 (GRCm39) missense probably damaging 1.00
Z1176:Sardh UTSW 2 27,108,902 (GRCm39) missense possibly damaging 0.52
Z1176:Sardh UTSW 2 27,108,846 (GRCm39) missense possibly damaging 0.88
Z1176:Sardh UTSW 2 27,086,685 (GRCm39) missense probably benign 0.08
Z1177:Sardh UTSW 2 27,125,525 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAAAACTCTGCTGGAGACC -3'
(R):5'- TGCAAGGACCCAGAAGTTCTG -3'

Sequencing Primer
(F):5'- GAGACCAGGCCTAGGAACTCTTC -3'
(R):5'- CAGAAGTTCTGTACCCCTGTGG -3'
Posted On 2016-03-01