Incidental Mutation 'R4842:Ptk6'
ID371890
Institutional Source Beutler Lab
Gene Symbol Ptk6
Ensembl Gene ENSMUSG00000038751
Gene NamePTK6 protein tyrosine kinase 6
SynonymsSik, Tksk
MMRRC Submission 042455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4842 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181193721-181202789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 181196991 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 323 (N323T)
Ref Sequence ENSEMBL: ENSMUSP00000016511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016511
AA Change: N323T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016511
Gene: ENSMUSG00000038751
AA Change: N323T

DomainStartEndE-ValueType
SH3 11 71 2e-16 SMART
SH2 76 161 1.01e-28 SMART
TyrKc 191 441 1.12e-131 SMART
Meta Mutation Damage Score 0.1555 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele display increased villus length in the jejunum and ileum and increased villus epithelial cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4930449A18Rik T A 3: 59,841,732 noncoding transcript Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamtsl3 C T 7: 82,528,861 R511C probably damaging Het
Arhgap11a T C 2: 113,839,762 S339G probably damaging Het
C2cd3 A G 7: 100,416,190 T728A probably benign Het
Cand1 C A 10: 119,213,546 probably null Het
Catspere1 A T 1: 177,872,058 noncoding transcript Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cdc16 A G 8: 13,781,644 probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Chrna7 A C 7: 63,212,448 L10R probably benign Het
Clnk C T 5: 38,713,069 probably null Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dennd2a T C 6: 39,497,110 D430G probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Eif2b1 A G 5: 124,576,908 S102P probably damaging Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fat3 A C 9: 15,997,587 V2373G probably damaging Het
Gadd45a A T 6: 67,036,889 L58Q probably damaging Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gldc T A 19: 30,133,732 N548I possibly damaging Het
Gm13035 A G 4: 146,073,423 noncoding transcript Het
Gm27013 T A 6: 130,520,737 noncoding transcript Het
Gm5436 A T 12: 84,258,810 noncoding transcript Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Hfm1 C A 5: 106,892,751 W716L probably damaging Het
Hist1h2bl C T 13: 21,716,064 probably benign Het
Il5ra T C 6: 106,738,375 Y166C probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kcnv2 A G 19: 27,323,790 D347G probably damaging Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Lamb1 C T 12: 31,287,433 H388Y probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lmbr1 G A 5: 29,287,426 T55I probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrp2 A T 2: 69,469,411 V3099E probably benign Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Map1a T A 2: 121,302,086 S890T probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myh7b C A 2: 155,633,989 L1935M probably benign Het
Myh9 T C 15: 77,769,253 E1348G probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nr1h3 A G 2: 91,190,218 F257L probably benign Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Olfr653 A T 7: 104,580,215 I190L probably benign Het
Pde1a T A 2: 80,128,837 probably benign Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pnkp C A 7: 44,861,646 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Rhox3c G A X: 37,470,424 A60T probably damaging Het
Rnf4 T A 5: 34,348,709 V61E probably damaging Het
Rnf5 A G 17: 34,602,003 probably benign Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sema5a C T 15: 32,609,417 H490Y probably benign Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stag3 T G 5: 138,309,365 probably null Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Tas2r116 G A 6: 132,855,697 S87N probably benign Het
Tomm6 T C 17: 47,688,069 probably benign Het
Trabd T C 15: 89,082,712 M113T probably benign Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vma21-ps T A 4: 52,496,943 D101V probably damaging Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Ptk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ptk6 APN 2 181195818 missense probably benign 0.00
IGL01630:Ptk6 APN 2 181197066 missense probably damaging 0.99
IGL01862:Ptk6 APN 2 181199640 missense probably benign 0.00
IGL02231:Ptk6 APN 2 181197001 missense probably damaging 1.00
IGL02965:Ptk6 APN 2 181199068 splice site probably benign
R0115:Ptk6 UTSW 2 181202527 start gained probably benign
R0139:Ptk6 UTSW 2 181196931 splice site probably benign
R0245:Ptk6 UTSW 2 181202491 missense probably benign
R0358:Ptk6 UTSW 2 181198522 missense probably benign 0.01
R0416:Ptk6 UTSW 2 181202308 missense possibly damaging 0.94
R0454:Ptk6 UTSW 2 181202282 missense possibly damaging 0.86
R0470:Ptk6 UTSW 2 181195939 missense probably benign
R0481:Ptk6 UTSW 2 181202527 start gained probably benign
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1234:Ptk6 UTSW 2 181202440 missense possibly damaging 0.94
R2249:Ptk6 UTSW 2 181196380 missense probably benign 0.03
R5568:Ptk6 UTSW 2 181199695 missense possibly damaging 0.47
R5806:Ptk6 UTSW 2 181199730 missense possibly damaging 0.95
R6017:Ptk6 UTSW 2 181195812 missense probably benign 0.32
R6285:Ptk6 UTSW 2 181197093 missense probably null 1.00
R6293:Ptk6 UTSW 2 181198460 missense probably damaging 1.00
R6468:Ptk6 UTSW 2 181199102 missense probably benign
R7369:Ptk6 UTSW 2 181198461 missense possibly damaging 0.86
X0062:Ptk6 UTSW 2 181202323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGAACAAGGCTGTGGCTG -3'
(R):5'- TAGCCACAGTAAATGAGGACTG -3'

Sequencing Primer
(F):5'- GCTGTATAGATAAAGCCATCTTGC -3'
(R):5'- CCACAGTAAATGAGGACTGGTCTCTG -3'
Posted On2016-03-01