Incidental Mutation 'R4842:Il5ra'
ID 371910
Institutional Source Beutler Lab
Gene Symbol Il5ra
Ensembl Gene ENSMUSG00000005364
Gene Name interleukin 5 receptor, alpha
Synonyms CDw125, IL-5 receptor alpha chain, CD125, Il5r
MMRRC Submission 042455-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R4842 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 106710357-106749037 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106738375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 166 (Y166C)
Ref Sequence ENSEMBL: ENSMUSP00000144718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167925] [ENSMUST00000204659] [ENSMUST00000205004]
AlphaFold P21183
Predicted Effect probably damaging
Transcript: ENSMUST00000167925
AA Change: Y166C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129781
Gene: ENSMUSG00000005364
AA Change: Y166C

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204659
AA Change: Y166C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144718
Gene: ENSMUSG00000005364
AA Change: Y166C

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205004
Meta Mutation Damage Score 0.9542 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype but with some immune system deficiencies. Mice homozygous for one knock-out allele exhibit increased metastasis of injected B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4930449A18Rik T A 3: 59,841,732 noncoding transcript Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamtsl3 C T 7: 82,528,861 R511C probably damaging Het
Arhgap11a T C 2: 113,839,762 S339G probably damaging Het
C2cd3 A G 7: 100,416,190 T728A probably benign Het
Cand1 C A 10: 119,213,546 probably null Het
Catspere1 A T 1: 177,872,058 noncoding transcript Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cdc16 A G 8: 13,781,644 probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Chrna7 A C 7: 63,212,448 L10R probably benign Het
Clnk C T 5: 38,713,069 probably null Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dennd2a T C 6: 39,497,110 D430G probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Eif2b1 A G 5: 124,576,908 S102P probably damaging Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fat3 A C 9: 15,997,587 V2373G probably damaging Het
Gadd45a A T 6: 67,036,889 L58Q probably damaging Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gldc T A 19: 30,133,732 N548I possibly damaging Het
Gm13035 A G 4: 146,073,423 noncoding transcript Het
Gm27013 T A 6: 130,520,737 noncoding transcript Het
Gm5436 A T 12: 84,258,810 noncoding transcript Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Hfm1 C A 5: 106,892,751 W716L probably damaging Het
Hist1h2bl C T 13: 21,716,064 probably benign Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kcnv2 A G 19: 27,323,790 D347G probably damaging Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Lamb1 C T 12: 31,287,433 H388Y probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lmbr1 G A 5: 29,287,426 T55I probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrp2 A T 2: 69,469,411 V3099E probably benign Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Map1a T A 2: 121,302,086 S890T probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myh7b C A 2: 155,633,989 L1935M probably benign Het
Myh9 T C 15: 77,769,253 E1348G probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nr1h3 A G 2: 91,190,218 F257L probably benign Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Olfr653 A T 7: 104,580,215 I190L probably benign Het
Pde1a T A 2: 80,128,837 probably benign Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pnkp C A 7: 44,861,646 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Ptk6 T G 2: 181,196,991 N323T possibly damaging Het
Rhox3c G A X: 37,470,424 A60T probably damaging Het
Rnf4 T A 5: 34,348,709 V61E probably damaging Het
Rnf5 A G 17: 34,602,003 probably benign Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sema5a C T 15: 32,609,417 H490Y probably benign Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stag3 T G 5: 138,309,365 probably null Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Tas2r116 G A 6: 132,855,697 S87N probably benign Het
Tomm6 T C 17: 47,688,069 probably benign Het
Trabd T C 15: 89,082,712 M113T probably benign Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vma21-ps T A 4: 52,496,943 D101V probably damaging Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Il5ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Il5ra APN 6 106712474 splice site probably benign
IGL00726:Il5ra APN 6 106738489 missense probably damaging 1.00
IGL01095:Il5ra APN 6 106742644 intron probably benign
IGL01562:Il5ra APN 6 106731904 missense probably benign 0.00
IGL01569:Il5ra APN 6 106731833 start codon destroyed probably null
IGL02346:Il5ra APN 6 106742658 missense probably benign 0.02
IGL02573:Il5ra APN 6 106716751 missense possibly damaging 0.93
IGL02659:Il5ra APN 6 106742683 missense possibly damaging 0.49
R0037:Il5ra UTSW 6 106742686 missense probably damaging 1.00
R0037:Il5ra UTSW 6 106742686 missense probably damaging 1.00
R0294:Il5ra UTSW 6 106712401 missense probably benign 0.41
R0463:Il5ra UTSW 6 106731890 missense probably damaging 0.99
R0478:Il5ra UTSW 6 106738462 missense probably benign
R0597:Il5ra UTSW 6 106744335 start codon destroyed probably null 0.99
R1526:Il5ra UTSW 6 106735820 missense possibly damaging 0.49
R1695:Il5ra UTSW 6 106738374 nonsense probably null
R1888:Il5ra UTSW 6 106731913 missense probably damaging 1.00
R1888:Il5ra UTSW 6 106731913 missense probably damaging 1.00
R2176:Il5ra UTSW 6 106738272 missense probably benign
R2207:Il5ra UTSW 6 106712441 nonsense probably null
R2973:Il5ra UTSW 6 106741235 missense probably benign 0.08
R4546:Il5ra UTSW 6 106738498 nonsense probably null
R4851:Il5ra UTSW 6 106738471 missense probably benign 0.06
R4911:Il5ra UTSW 6 106715668 missense probably damaging 1.00
R4936:Il5ra UTSW 6 106738162 missense possibly damaging 0.90
R5297:Il5ra UTSW 6 106738134 missense probably benign 0.09
R6035:Il5ra UTSW 6 106741265 missense probably damaging 1.00
R6035:Il5ra UTSW 6 106741265 missense probably damaging 1.00
R8103:Il5ra UTSW 6 106715650 missense possibly damaging 0.87
R8338:Il5ra UTSW 6 106712389 missense probably benign 0.09
R8497:Il5ra UTSW 6 106738105 missense probably benign 0.01
R8936:Il5ra UTSW 6 106715643 missense possibly damaging 0.94
R9397:Il5ra UTSW 6 106744297 missense probably benign 0.10
R9576:Il5ra UTSW 6 106735727 missense probably damaging 1.00
R9583:Il5ra UTSW 6 106712370 missense unknown
R9583:Il5ra UTSW 6 106744336 start codon destroyed possibly damaging 0.84
Z1177:Il5ra UTSW 6 106741134 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCTCAAACCCTTTGC -3'
(R):5'- GCATAAAATTCAGAAGCCATCAAGG -3'

Sequencing Primer
(F):5'- GCTGTTGATAAATGTCCTGGGAAAC -3'
(R):5'- CCATCAAGGCAATGTTTTGTCC -3'
Posted On 2016-03-01