Mutagenetix > Incidental Mutation

Incidental Mutation 'R4842:Adamtsl3'

371919

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl3

Ensembl Gene

ENSMUSG00000070469

Gene Name

ADAMTS-like 3

Synonyms

punctin-2, 9230119C12Rik

MMRRC Submission

042455-MU

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4842 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82335694-82614450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 82528861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 511 (R511C)

Ref Sequence

ENSEMBL: ENSMUSP00000133637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]

AlphaFold

G3UXC7

Predicted Effect

probably damaging
Transcript: ENSMUST00000173287
AA Change: R511C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: R511C

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	90	136	6.43e-8	SMART
TSP1	355	414	1.59e-1	SMART
TSP1	433	492	3.72e-4	SMART
TSP1	494	547	4.28e-4	SMART
TSP1	579	638	1.85e-2	SMART
TSP1	660	717	1.75e-2	SMART
TSP1	719	773	3.45e-8	SMART
TSP1	775	833	3.67e-3	SMART
TSP1	836	894	8.99e-2	SMART
IGc2	938	1002	7.59e-4	SMART
IG	1213	1296	4.87e0	SMART
IGc2	1326	1388	1.01e-13	SMART
TSP1	1441	1498	1.95e-2	SMART
TSP1	1500	1559	6.76e-2	SMART
TSP1	1616	1666	3.84e-1	SMART
Pfam:PLAC	1674	1704	2.4e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173828

SMART Domains

Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Blast:IG	22	79	1e-26	BLAST
SCOP:d1biha4	27	77	2e-5	SMART
IG	283	366	4.87e0	SMART
IGc2	396	458	1.01e-13	SMART
TSP1	511	568	1.95e-2	SMART
TSP1	570	629	6.76e-2	SMART
TSP1	686	736	3.84e-1	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

95% (107/113)

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	A	T	17: 14,943,739	I43L	possibly damaging	Het
4930449A18Rik	T	A	3: 59,841,732		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,150,722	C1198S	probably damaging	Het
Abcc8	T	C	7: 46,150,828	K510R	probably damaging	Het
Arhgap11a	T	C	2: 113,839,762	S339G	probably damaging	Het
C2cd3	A	G	7: 100,416,190	T728A	probably benign	Het
Cand1	C	A	10: 119,213,546		probably null	Het
Catspere1	A	T	1: 177,872,058		noncoding transcript	Het
Cd209c	G	T	8: 3,945,905	R2S	probably benign	Het
Cdc16	A	G	8: 13,781,644		probably benign	Het
Ces1g	C	T	8: 93,333,695	E99K	probably benign	Het
Chrna7	A	C	7: 63,212,448	L10R	probably benign	Het
Clnk	C	T	5: 38,713,069		probably null	Het
Cntrob	C	G	11: 69,315,394	L315F	possibly damaging	Het
Ctdp1	A	G	18: 80,408,726	S145P	unknown	Het
Dennd2a	T	C	6: 39,497,110	D430G	probably damaging	Het
Dnajc16	A	G	4: 141,774,625	F298S	probably damaging	Het
Dock5	T	C	14: 67,817,563	D618G	probably damaging	Het
Drc3	G	A	11: 60,370,535	A171T	probably benign	Het
Ecel1	A	T	1: 87,153,301	N322K	probably damaging	Het
Eftud2	A	G	11: 102,854,814	F362L	probably damaging	Het
Egfr	C	T	11: 16,911,607	H1129Y	probably benign	Het
Eif2b1	A	G	5: 124,576,908	S102P	probably damaging	Het
Erich3	T	A	3: 154,704,843	F112I	possibly damaging	Het
Fam107b	T	C	2: 3,778,543	L261S	probably damaging	Het
Fam198b	G	A	3: 79,936,605	R377H	probably damaging	Het
Fat3	A	C	9: 15,997,587	V2373G	probably damaging	Het
Gadd45a	A	T	6: 67,036,889	L58Q	probably damaging	Het
Gipr	C	T	7: 19,162,676	R165H	probably damaging	Het
Gje1	C	T	10: 14,717,338	G45R	probably null	Het
Gldc	T	A	19: 30,133,732	N548I	possibly damaging	Het
Gm13035	A	G	4: 146,073,423		noncoding transcript	Het
Gm27013	T	A	6: 130,520,737		noncoding transcript	Het
Gm5436	A	T	12: 84,258,810		noncoding transcript	Het
Gm6588	A	T	5: 112,450,240	K218*	probably null	Het
Grik3	C	A	4: 125,691,176	N612K	probably damaging	Het
Hfm1	C	A	5: 106,892,751	W716L	probably damaging	Het
Hist1h2bl	C	T	13: 21,716,064		probably benign	Het
Il5ra	T	C	6: 106,738,375	Y166C	probably damaging	Het
Iqcb1	A	G	16: 36,835,590	E113G	probably benign	Het
Kcnk10	A	T	12: 98,434,916	M486K	probably benign	Het
Kcnv2	A	G	19: 27,323,790	D347G	probably damaging	Het
Kif21b	C	A	1: 136,145,220	H119N	probably damaging	Het
Lamb1	C	T	12: 31,287,433	H388Y	probably damaging	Het
Leng9	T	C	7: 4,149,386	D97G	probably damaging	Het
Lmbr1	G	A	5: 29,287,426	T55I	probably damaging	Het
Lrp1	G	T	10: 127,583,936	R935S	probably damaging	Het
Lrp2	A	T	2: 69,469,411	V3099E	probably benign	Het
Lrrcc1	C	A	3: 14,562,511	D503E	probably benign	Het
Map1a	T	A	2: 121,302,086	S890T	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mybph	A	T	1: 134,198,495	E349V	probably damaging	Het
Myh7b	C	A	2: 155,633,989	L1935M	probably benign	Het
Myh9	T	C	15: 77,769,253	E1348G	probably damaging	Het
Myzap	A	G	9: 71,548,755	S328P	probably damaging	Het
Nbeal1	T	C	1: 60,253,375	L1062P	probably damaging	Het
Nepro	G	A	16: 44,734,797	S412N	probably null	Het
Nr1h3	A	G	2: 91,190,218	F257L	probably benign	Het
Nudt5	T	C	2: 5,864,428	V155A	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr522	A	G	7: 140,162,689	L87P	possibly damaging	Het
Olfr539	A	T	7: 140,667,589	I94F	probably damaging	Het
Olfr653	A	T	7: 104,580,215	I190L	probably benign	Het
Pde1a	T	A	2: 80,128,837		probably benign	Het
Pde4dip	T	A	3: 97,793,528	H220L	probably damaging	Het
Pde9a	T	A	17: 31,443,161		probably null	Het
Pnkp	C	A	7: 44,861,646		probably null	Het
Pnpla7	A	G	2: 24,980,052	T15A	probably benign	Het
Polq	G	T	16: 37,048,783		probably null	Het
Ppfia2	C	T	10: 106,854,957	T553I	probably benign	Het
Ptk6	T	G	2: 181,196,991	N323T	possibly damaging	Het
Rhox3c	G	A	X: 37,470,424	A60T	probably damaging	Het
Rnf4	T	A	5: 34,348,709	V61E	probably damaging	Het
Rnf5	A	G	17: 34,602,003		probably benign	Het
Sardh	A	G	2: 27,191,955	V853A	probably benign	Het
Scfd1	T	C	12: 51,389,326	V86A	probably damaging	Het
Scube3	G	A	17: 28,164,123	C425Y	probably damaging	Het
Sema5a	C	T	15: 32,609,417	H490Y	probably benign	Het
Sfta2	T	C	17: 35,649,881		probably benign	Het
Sh3d19	T	C	3: 86,123,742	Y738H	probably damaging	Het
Shc2	T	C	10: 79,622,461	R463G	probably damaging	Het
Socs7	T	A	11: 97,377,003	I320N	possibly damaging	Het
Speer2	A	T	16: 69,858,100	M159K	probably benign	Het
Sppl2c	A	C	11: 104,187,652	H426P	probably benign	Het
Stag3	T	G	5: 138,309,365		probably null	Het
Stxbp5	C	A	10: 9,762,891	V1055L	probably benign	Het
Synpo	A	T	18: 60,603,612	S421T	probably damaging	Het
Taf6l	A	G	19: 8,782,406	V135A	possibly damaging	Het
Tas2r116	G	A	6: 132,855,697	S87N	probably benign	Het
Tomm6	T	C	17: 47,688,069		probably benign	Het
Trabd	T	C	15: 89,082,712	M113T	probably benign	Het
Trim58	G	A	11: 58,651,324	G370E	probably damaging	Het
Ttc41	C	T	10: 86,731,125	R552C	probably benign	Het
Vit	T	C	17: 78,601,879	S252P	probably benign	Het
Vma21-ps	T	A	4: 52,496,943	D101V	probably damaging	Het
Vmn1r173	A	T	7: 23,702,936	I199F	probably damaging	Het
Vmn2r114	T	A	17: 23,310,362	R255S	probably benign	Het
Vmn2r17	A	G	5: 109,434,380	N545S	probably damaging	Het
Zfp865	A	G	7: 5,031,641	Y875C	probably damaging	Het

Other mutations in Adamtsl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01549:Adamtsl3	APN	7	82612448	missense	probably damaging	1.00
IGL01936:Adamtsl3	APN	7	82595371	missense	possibly damaging	0.93
IGL02819:Adamtsl3	APN	7	82574121	missense	probably damaging	0.99
P0012:Adamtsl3	UTSW	7	82574257	missense	probably benign	0.27
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0096:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0180:Adamtsl3	UTSW	7	82575990	missense	probably benign	0.00
R0270:Adamtsl3	UTSW	7	82556824	missense	probably damaging	1.00
R0295:Adamtsl3	UTSW	7	82548005	critical splice donor site	probably null
R0329:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0330:Adamtsl3	UTSW	7	82521990	missense	probably damaging	1.00
R0548:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R0611:Adamtsl3	UTSW	7	82528912	missense	probably damaging	1.00
R0671:Adamtsl3	UTSW	7	82523182	missense	probably damaging	1.00
R0711:Adamtsl3	UTSW	7	82465699	intron	probably benign
R0845:Adamtsl3	UTSW	7	82575996	missense	probably damaging	1.00
R1119:Adamtsl3	UTSW	7	82540317	missense	probably damaging	0.96
R1458:Adamtsl3	UTSW	7	82523320	missense	probably damaging	1.00
R1644:Adamtsl3	UTSW	7	82450090	missense	possibly damaging	0.87
R1691:Adamtsl3	UTSW	7	82499606	missense	probably damaging	1.00
R1838:Adamtsl3	UTSW	7	82493373	missense	probably damaging	1.00
R2131:Adamtsl3	UTSW	7	82578594	missense	probably damaging	1.00
R2245:Adamtsl3	UTSW	7	82450100	missense	probably damaging	1.00
R2274:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2275:Adamtsl3	UTSW	7	82606558	missense	probably benign	0.37
R2448:Adamtsl3	UTSW	7	82499748	missense	probably damaging	1.00
R3725:Adamtsl3	UTSW	7	82612404	missense	possibly damaging	0.80
R3757:Adamtsl3	UTSW	7	82337207	missense	probably benign	0.01
R3821:Adamtsl3	UTSW	7	82606479	splice site	probably benign
R4618:Adamtsl3	UTSW	7	82606520	missense	probably benign	0.41
R4887:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4888:Adamtsl3	UTSW	7	82574614	missense	possibly damaging	0.87
R4925:Adamtsl3	UTSW	7	82602299	critical splice donor site	probably null
R4960:Adamtsl3	UTSW	7	82566977	missense	probably damaging	0.99
R5026:Adamtsl3	UTSW	7	82576054	missense	probably benign	0.07
R5152:Adamtsl3	UTSW	7	82574544	missense	probably benign	0.11
R5198:Adamtsl3	UTSW	7	82611798	missense	possibly damaging	0.63
R5244:Adamtsl3	UTSW	7	82598069	missense	probably benign	0.02
R5281:Adamtsl3	UTSW	7	82528934	missense	probably damaging	1.00
R5323:Adamtsl3	UTSW	7	82557061	missense	probably damaging	1.00
R5523:Adamtsl3	UTSW	7	82574442	missense	possibly damaging	0.86
R5602:Adamtsl3	UTSW	7	82557239	missense	possibly damaging	0.89
R5638:Adamtsl3	UTSW	7	82611750	missense	probably damaging	0.99
R5682:Adamtsl3	UTSW	7	82606550	missense	probably damaging	0.99
R5782:Adamtsl3	UTSW	7	82540286	splice site	probably null
R5946:Adamtsl3	UTSW	7	82576057	missense	probably damaging	0.98
R6091:Adamtsl3	UTSW	7	82465621	missense	probably damaging	1.00
R6258:Adamtsl3	UTSW	7	82528983	critical splice donor site	probably null
R6500:Adamtsl3	UTSW	7	82578610	missense	probably benign	0.00
R6765:Adamtsl3	UTSW	7	82567024	missense	possibly damaging	0.60
R6785:Adamtsl3	UTSW	7	82522004	missense	probably damaging	0.99
R6982:Adamtsl3	UTSW	7	82515063	missense	probably damaging	1.00
R7109:Adamtsl3	UTSW	7	82611861	missense
R7341:Adamtsl3	UTSW	7	82556874	missense	probably damaging	1.00
R7402:Adamtsl3	UTSW	7	82578617	missense	probably damaging	0.96
R7506:Adamtsl3	UTSW	7	82514978	missense	probably damaging	1.00
R7549:Adamtsl3	UTSW	7	82573909	missense	probably damaging	1.00
R7575:Adamtsl3	UTSW	7	82574548	missense	possibly damaging	0.85
R7592:Adamtsl3	UTSW	7	82337251	missense	probably benign	0.00
R7617:Adamtsl3	UTSW	7	82556846	splice site	probably null
R7654:Adamtsl3	UTSW	7	82574494	missense	probably benign
R7721:Adamtsl3	UTSW	7	82606520	missense	possibly damaging	0.62
R7784:Adamtsl3	UTSW	7	82573989	missense	probably damaging	1.00
R7858:Adamtsl3	UTSW	7	82450163	missense	probably damaging	1.00
R8109:Adamtsl3	UTSW	7	82602279	missense	possibly damaging	0.94
R8125:Adamtsl3	UTSW	7	82450333	splice site	probably null
R8211:Adamtsl3	UTSW	7	82523163	missense	probably damaging	1.00
R8348:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8360:Adamtsl3	UTSW	7	82547979	missense	probably damaging	1.00
R8448:Adamtsl3	UTSW	7	82603799	missense	possibly damaging	0.89
R8465:Adamtsl3	UTSW	7	82598122	missense	probably benign	0.43
R8547:Adamtsl3	UTSW	7	82428413	missense	probably damaging	1.00
R8551:Adamtsl3	UTSW	7	82540470	missense	probably benign	0.34
R8558:Adamtsl3	UTSW	7	82428392	missense	possibly damaging	0.59
R8709:Adamtsl3	UTSW	7	82428434	missense	possibly damaging	0.94
R8722:Adamtsl3	UTSW	7	82595537	critical splice donor site	probably null
R8930:Adamtsl3	UTSW	7	82611861	missense
R8932:Adamtsl3	UTSW	7	82611861	missense
R9131:Adamtsl3	UTSW	7	82595514	missense	probably benign	0.00
R9169:Adamtsl3	UTSW	7	82573980	missense	probably damaging	0.99
R9272:Adamtsl3	UTSW	7	82540545	missense	probably damaging	1.00
R9276:Adamtsl3	UTSW	7	82557502	intron	probably benign
R9351:Adamtsl3	UTSW	7	82520721	missense	possibly damaging	0.94
R9352:Adamtsl3	UTSW	7	82442448	missense	probably damaging	1.00
R9749:Adamtsl3	UTSW	7	82450186	missense	probably benign	0.04
R9750:Adamtsl3	UTSW	7	82595381	missense	probably benign	0.11
RF005:Adamtsl3	UTSW	7	82612395	missense
X0003:Adamtsl3	UTSW	7	82611759	nonsense	probably null
X0063:Adamtsl3	UTSW	7	82574157	missense	probably benign	0.25
Z1088:Adamtsl3	UTSW	7	82499714	missense	probably damaging	1.00
Z1088:Adamtsl3	UTSW	7	82540325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGCACCAGATACATGCAG -3'
(R):5'- ACCTGGAAAACCCTGTTTGAC -3'

Sequencing Primer
(F):5'- ACCAGATACATGCAGAAAAAGTATC -3'
(R):5'- CTGGAAAACCCTGTTTGACTTCAG -3'

Posted On

2016-03-01