Mutagenetix > Incidental Mutation

Incidental Mutation 'R4842:Olfr539'

371923

Institutional Source

Beutler Lab

Gene Symbol

Olfr539

Ensembl Gene

ENSMUSG00000059136

Gene Name

olfactory receptor 539

Synonyms

MOR253-4, GA_x6K02T2PBJ9-42813436-42814368

MMRRC Submission

042455-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R4842 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140659930-140678580 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 140667589 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 94 (I94F)

Ref Sequence

ENSEMBL: ENSMUSP00000151522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000210973] [ENSMUST00000218865]

AlphaFold

Q8VGL9

Predicted Effect

probably damaging
Transcript: ENSMUST00000078967
AA Change: I101F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: I101F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	40	316	6.5e-50	PFAM
Pfam:7tm_1	50	299	4.9e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210499

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210973
AA Change: I94F

Predicted Effect

probably damaging
Transcript: ENSMUST00000218865
AA Change: I94F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219853

Meta Mutation Damage Score

0.3295

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

95% (107/113)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	A	T	17: 14,943,739	I43L	possibly damaging	Het
4930449A18Rik	T	A	3: 59,841,732		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,150,722	C1198S	probably damaging	Het
Abcc8	T	C	7: 46,150,828	K510R	probably damaging	Het
Adamtsl3	C	T	7: 82,528,861	R511C	probably damaging	Het
Arhgap11a	T	C	2: 113,839,762	S339G	probably damaging	Het
C2cd3	A	G	7: 100,416,190	T728A	probably benign	Het
Cand1	C	A	10: 119,213,546		probably null	Het
Catspere1	A	T	1: 177,872,058		noncoding transcript	Het
Cd209c	G	T	8: 3,945,905	R2S	probably benign	Het
Cdc16	A	G	8: 13,781,644		probably benign	Het
Ces1g	C	T	8: 93,333,695	E99K	probably benign	Het
Chrna7	A	C	7: 63,212,448	L10R	probably benign	Het
Clnk	C	T	5: 38,713,069		probably null	Het
Cntrob	C	G	11: 69,315,394	L315F	possibly damaging	Het
Ctdp1	A	G	18: 80,408,726	S145P	unknown	Het
Dennd2a	T	C	6: 39,497,110	D430G	probably damaging	Het
Dnajc16	A	G	4: 141,774,625	F298S	probably damaging	Het
Dock5	T	C	14: 67,817,563	D618G	probably damaging	Het
Drc3	G	A	11: 60,370,535	A171T	probably benign	Het
Ecel1	A	T	1: 87,153,301	N322K	probably damaging	Het
Eftud2	A	G	11: 102,854,814	F362L	probably damaging	Het
Egfr	C	T	11: 16,911,607	H1129Y	probably benign	Het
Eif2b1	A	G	5: 124,576,908	S102P	probably damaging	Het
Erich3	T	A	3: 154,704,843	F112I	possibly damaging	Het
Fam107b	T	C	2: 3,778,543	L261S	probably damaging	Het
Fam198b	G	A	3: 79,936,605	R377H	probably damaging	Het
Fat3	A	C	9: 15,997,587	V2373G	probably damaging	Het
Gadd45a	A	T	6: 67,036,889	L58Q	probably damaging	Het
Gipr	C	T	7: 19,162,676	R165H	probably damaging	Het
Gje1	C	T	10: 14,717,338	G45R	probably null	Het
Gldc	T	A	19: 30,133,732	N548I	possibly damaging	Het
Gm13035	A	G	4: 146,073,423		noncoding transcript	Het
Gm27013	T	A	6: 130,520,737		noncoding transcript	Het
Gm5436	A	T	12: 84,258,810		noncoding transcript	Het
Gm6588	A	T	5: 112,450,240	K218*	probably null	Het
Grik3	C	A	4: 125,691,176	N612K	probably damaging	Het
Hfm1	C	A	5: 106,892,751	W716L	probably damaging	Het
Hist1h2bl	C	T	13: 21,716,064		probably benign	Het
Il5ra	T	C	6: 106,738,375	Y166C	probably damaging	Het
Iqcb1	A	G	16: 36,835,590	E113G	probably benign	Het
Kcnk10	A	T	12: 98,434,916	M486K	probably benign	Het
Kcnv2	A	G	19: 27,323,790	D347G	probably damaging	Het
Kif21b	C	A	1: 136,145,220	H119N	probably damaging	Het
Lamb1	C	T	12: 31,287,433	H388Y	probably damaging	Het
Leng9	T	C	7: 4,149,386	D97G	probably damaging	Het
Lmbr1	G	A	5: 29,287,426	T55I	probably damaging	Het
Lrp1	G	T	10: 127,583,936	R935S	probably damaging	Het
Lrp2	A	T	2: 69,469,411	V3099E	probably benign	Het
Lrrcc1	C	A	3: 14,562,511	D503E	probably benign	Het
Map1a	T	A	2: 121,302,086	S890T	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mybph	A	T	1: 134,198,495	E349V	probably damaging	Het
Myh7b	C	A	2: 155,633,989	L1935M	probably benign	Het
Myh9	T	C	15: 77,769,253	E1348G	probably damaging	Het
Myzap	A	G	9: 71,548,755	S328P	probably damaging	Het
Nbeal1	T	C	1: 60,253,375	L1062P	probably damaging	Het
Nepro	G	A	16: 44,734,797	S412N	probably null	Het
Nr1h3	A	G	2: 91,190,218	F257L	probably benign	Het
Nudt5	T	C	2: 5,864,428	V155A	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr522	A	G	7: 140,162,689	L87P	possibly damaging	Het
Olfr653	A	T	7: 104,580,215	I190L	probably benign	Het
Pde1a	T	A	2: 80,128,837		probably benign	Het
Pde4dip	T	A	3: 97,793,528	H220L	probably damaging	Het
Pde9a	T	A	17: 31,443,161		probably null	Het
Pnkp	C	A	7: 44,861,646		probably null	Het
Pnpla7	A	G	2: 24,980,052	T15A	probably benign	Het
Polq	G	T	16: 37,048,783		probably null	Het
Ppfia2	C	T	10: 106,854,957	T553I	probably benign	Het
Ptk6	T	G	2: 181,196,991	N323T	possibly damaging	Het
Rhox3c	G	A	X: 37,470,424	A60T	probably damaging	Het
Rnf4	T	A	5: 34,348,709	V61E	probably damaging	Het
Rnf5	A	G	17: 34,602,003		probably benign	Het
Sardh	A	G	2: 27,191,955	V853A	probably benign	Het
Scfd1	T	C	12: 51,389,326	V86A	probably damaging	Het
Scube3	G	A	17: 28,164,123	C425Y	probably damaging	Het
Sema5a	C	T	15: 32,609,417	H490Y	probably benign	Het
Sfta2	T	C	17: 35,649,881		probably benign	Het
Sh3d19	T	C	3: 86,123,742	Y738H	probably damaging	Het
Shc2	T	C	10: 79,622,461	R463G	probably damaging	Het
Socs7	T	A	11: 97,377,003	I320N	possibly damaging	Het
Speer2	A	T	16: 69,858,100	M159K	probably benign	Het
Sppl2c	A	C	11: 104,187,652	H426P	probably benign	Het
Stag3	T	G	5: 138,309,365		probably null	Het
Stxbp5	C	A	10: 9,762,891	V1055L	probably benign	Het
Synpo	A	T	18: 60,603,612	S421T	probably damaging	Het
Taf6l	A	G	19: 8,782,406	V135A	possibly damaging	Het
Tas2r116	G	A	6: 132,855,697	S87N	probably benign	Het
Tomm6	T	C	17: 47,688,069		probably benign	Het
Trabd	T	C	15: 89,082,712	M113T	probably benign	Het
Trim58	G	A	11: 58,651,324	G370E	probably damaging	Het
Ttc41	C	T	10: 86,731,125	R552C	probably benign	Het
Vit	T	C	17: 78,601,879	S252P	probably benign	Het
Vma21-ps	T	A	4: 52,496,943	D101V	probably damaging	Het
Vmn1r173	A	T	7: 23,702,936	I199F	probably damaging	Het
Vmn2r114	T	A	17: 23,310,362	R255S	probably benign	Het
Vmn2r17	A	G	5: 109,434,380	N545S	probably damaging	Het
Zfp865	A	G	7: 5,031,641	Y875C	probably damaging	Het

Other mutations in Olfr539

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Olfr539	APN	7	140667941	missense	probably benign	0.01
IGL01610:Olfr539	APN	7	140667671	missense	probably damaging	1.00
IGL02959:Olfr539	APN	7	140667550	missense	probably damaging	1.00
IGL03406:Olfr539	APN	7	140667511	missense	probably damaging	1.00
R0671:Olfr539	UTSW	7	140667677	missense	probably damaging	1.00
R1771:Olfr539	UTSW	7	140668135	missense	probably benign
R1934:Olfr539	UTSW	7	140668038	nonsense	probably null
R1985:Olfr539	UTSW	7	140667821	missense	probably damaging	1.00
R2962:Olfr539	UTSW	7	140667949	missense	probably benign
R4239:Olfr539	UTSW	7	140667583	missense	probably benign	0.07
R4240:Olfr539	UTSW	7	140667583	missense	probably benign	0.07
R4360:Olfr539	UTSW	7	140667817	missense	probably damaging	0.98
R4841:Olfr539	UTSW	7	140667589	missense	probably damaging	1.00
R4851:Olfr539	UTSW	7	140667313	missense	probably benign
R5325:Olfr539	UTSW	7	140667792	missense	probably benign	0.33
R5766:Olfr539	UTSW	7	140667353	missense	probably benign	0.02
R6363:Olfr539	UTSW	7	140668082	missense	possibly damaging	0.93
R6836:Olfr539	UTSW	7	140668180	missense	possibly damaging	0.86
R7777:Olfr539	UTSW	7	140667941	missense	probably benign	0.01
R7920:Olfr539	UTSW	7	140667901	missense	possibly damaging	0.92
R8134:Olfr539	UTSW	7	140667767	missense	possibly damaging	0.90
R8712:Olfr539	UTSW	7	140668139	missense	possibly damaging	0.89
R9095:Olfr539	UTSW	7	140667900	missense	probably damaging	1.00
R9158:Olfr539	UTSW	7	140667634	missense	possibly damaging	0.76
R9603:Olfr539	UTSW	7	140667881	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCCTCTACATGATGGCTC -3'
(R):5'- GCGTGTCATTAGACCAGTGTG -3'

Sequencing Primer
(F):5'- CTACATGATGGCTCTAATGGGCAAC -3'
(R):5'- GTGTGGACACATGCATTCAC -3'

Posted On

2016-03-01