Mutagenetix > Incidental Mutation

Incidental Mutation 'R4842:Stxbp5'

371930

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

042455-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4842 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 9762891 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 1055 (V1055L)

Ref Sequence

ENSEMBL: ENSMUSP00000123253 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

probably benign
Transcript: ENSMUST00000038213
AA Change: V1091L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: V1091L

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000125200
AA Change: V1038L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: V1038L

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136259

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139199

Predicted Effect

probably benign
Transcript: ENSMUST00000141722
AA Change: V1055L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: V1055L

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151435

Meta Mutation Damage Score

0.0806

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

95% (107/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	A	T	17: 14,943,739	I43L	possibly damaging	Het
4930449A18Rik	T	A	3: 59,841,732		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,150,722	C1198S	probably damaging	Het
Abcc8	T	C	7: 46,150,828	K510R	probably damaging	Het
Adamtsl3	C	T	7: 82,528,861	R511C	probably damaging	Het
Arhgap11a	T	C	2: 113,839,762	S339G	probably damaging	Het
C2cd3	A	G	7: 100,416,190	T728A	probably benign	Het
Cand1	C	A	10: 119,213,546		probably null	Het
Catspere1	A	T	1: 177,872,058		noncoding transcript	Het
Cd209c	G	T	8: 3,945,905	R2S	probably benign	Het
Cdc16	A	G	8: 13,781,644		probably benign	Het
Ces1g	C	T	8: 93,333,695	E99K	probably benign	Het
Chrna7	A	C	7: 63,212,448	L10R	probably benign	Het
Clnk	C	T	5: 38,713,069		probably null	Het
Cntrob	C	G	11: 69,315,394	L315F	possibly damaging	Het
Ctdp1	A	G	18: 80,408,726	S145P	unknown	Het
Dennd2a	T	C	6: 39,497,110	D430G	probably damaging	Het
Dnajc16	A	G	4: 141,774,625	F298S	probably damaging	Het
Dock5	T	C	14: 67,817,563	D618G	probably damaging	Het
Drc3	G	A	11: 60,370,535	A171T	probably benign	Het
Ecel1	A	T	1: 87,153,301	N322K	probably damaging	Het
Eftud2	A	G	11: 102,854,814	F362L	probably damaging	Het
Egfr	C	T	11: 16,911,607	H1129Y	probably benign	Het
Eif2b1	A	G	5: 124,576,908	S102P	probably damaging	Het
Erich3	T	A	3: 154,704,843	F112I	possibly damaging	Het
Fam107b	T	C	2: 3,778,543	L261S	probably damaging	Het
Fam198b	G	A	3: 79,936,605	R377H	probably damaging	Het
Fat3	A	C	9: 15,997,587	V2373G	probably damaging	Het
Gadd45a	A	T	6: 67,036,889	L58Q	probably damaging	Het
Gipr	C	T	7: 19,162,676	R165H	probably damaging	Het
Gje1	C	T	10: 14,717,338	G45R	probably null	Het
Gldc	T	A	19: 30,133,732	N548I	possibly damaging	Het
Gm13035	A	G	4: 146,073,423		noncoding transcript	Het
Gm27013	T	A	6: 130,520,737		noncoding transcript	Het
Gm5436	A	T	12: 84,258,810		noncoding transcript	Het
Gm6588	A	T	5: 112,450,240	K218*	probably null	Het
Grik3	C	A	4: 125,691,176	N612K	probably damaging	Het
Hfm1	C	A	5: 106,892,751	W716L	probably damaging	Het
Hist1h2bl	C	T	13: 21,716,064		probably benign	Het
Il5ra	T	C	6: 106,738,375	Y166C	probably damaging	Het
Iqcb1	A	G	16: 36,835,590	E113G	probably benign	Het
Kcnk10	A	T	12: 98,434,916	M486K	probably benign	Het
Kcnv2	A	G	19: 27,323,790	D347G	probably damaging	Het
Kif21b	C	A	1: 136,145,220	H119N	probably damaging	Het
Lamb1	C	T	12: 31,287,433	H388Y	probably damaging	Het
Leng9	T	C	7: 4,149,386	D97G	probably damaging	Het
Lmbr1	G	A	5: 29,287,426	T55I	probably damaging	Het
Lrp1	G	T	10: 127,583,936	R935S	probably damaging	Het
Lrp2	A	T	2: 69,469,411	V3099E	probably benign	Het
Lrrcc1	C	A	3: 14,562,511	D503E	probably benign	Het
Map1a	T	A	2: 121,302,086	S890T	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mybph	A	T	1: 134,198,495	E349V	probably damaging	Het
Myh7b	C	A	2: 155,633,989	L1935M	probably benign	Het
Myh9	T	C	15: 77,769,253	E1348G	probably damaging	Het
Myzap	A	G	9: 71,548,755	S328P	probably damaging	Het
Nbeal1	T	C	1: 60,253,375	L1062P	probably damaging	Het
Nepro	G	A	16: 44,734,797	S412N	probably null	Het
Nr1h3	A	G	2: 91,190,218	F257L	probably benign	Het
Nudt5	T	C	2: 5,864,428	V155A	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr522	A	G	7: 140,162,689	L87P	possibly damaging	Het
Olfr539	A	T	7: 140,667,589	I94F	probably damaging	Het
Olfr653	A	T	7: 104,580,215	I190L	probably benign	Het
Pde1a	T	A	2: 80,128,837		probably benign	Het
Pde4dip	T	A	3: 97,793,528	H220L	probably damaging	Het
Pde9a	T	A	17: 31,443,161		probably null	Het
Pnkp	C	A	7: 44,861,646		probably null	Het
Pnpla7	A	G	2: 24,980,052	T15A	probably benign	Het
Polq	G	T	16: 37,048,783		probably null	Het
Ppfia2	C	T	10: 106,854,957	T553I	probably benign	Het
Ptk6	T	G	2: 181,196,991	N323T	possibly damaging	Het
Rhox3c	G	A	X: 37,470,424	A60T	probably damaging	Het
Rnf4	T	A	5: 34,348,709	V61E	probably damaging	Het
Rnf5	A	G	17: 34,602,003		probably benign	Het
Sardh	A	G	2: 27,191,955	V853A	probably benign	Het
Scfd1	T	C	12: 51,389,326	V86A	probably damaging	Het
Scube3	G	A	17: 28,164,123	C425Y	probably damaging	Het
Sema5a	C	T	15: 32,609,417	H490Y	probably benign	Het
Sfta2	T	C	17: 35,649,881		probably benign	Het
Sh3d19	T	C	3: 86,123,742	Y738H	probably damaging	Het
Shc2	T	C	10: 79,622,461	R463G	probably damaging	Het
Socs7	T	A	11: 97,377,003	I320N	possibly damaging	Het
Speer2	A	T	16: 69,858,100	M159K	probably benign	Het
Sppl2c	A	C	11: 104,187,652	H426P	probably benign	Het
Stag3	T	G	5: 138,309,365		probably null	Het
Synpo	A	T	18: 60,603,612	S421T	probably damaging	Het
Taf6l	A	G	19: 8,782,406	V135A	possibly damaging	Het
Tas2r116	G	A	6: 132,855,697	S87N	probably benign	Het
Tomm6	T	C	17: 47,688,069		probably benign	Het
Trabd	T	C	15: 89,082,712	M113T	probably benign	Het
Trim58	G	A	11: 58,651,324	G370E	probably damaging	Het
Ttc41	C	T	10: 86,731,125	R552C	probably benign	Het
Vit	T	C	17: 78,601,879	S252P	probably benign	Het
Vma21-ps	T	A	4: 52,496,943	D101V	probably damaging	Het
Vmn1r173	A	T	7: 23,702,936	I199F	probably damaging	Het
Vmn2r114	T	A	17: 23,310,362	R255S	probably benign	Het
Vmn2r17	A	G	5: 109,434,380	N545S	probably damaging	Het
Zfp865	A	G	7: 5,031,641	Y875C	probably damaging	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
R9172:Stxbp5	UTSW	10	9769408	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9843357	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9812010	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9899194	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GTGACCAAGTGCCTGCATAC -3'
(R):5'- CCAAATTTCTGCTGTGTGATCTGG -3'

Sequencing Primer
(F):5'- AGTGCCTGCATACCTCATGAG -3'
(R):5'- AAAATGTTTAGAGTGGTGCACTG -3'

Posted On

2016-03-01