Incidental Mutation 'R4842:Stxbp5'
ID371930
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission 042455-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4842 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 9762891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1055 (V1055L)
Ref Sequence ENSEMBL: ENSMUSP00000123253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
Predicted Effect probably benign
Transcript: ENSMUST00000038213
AA Change: V1091L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: V1091L

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000125200
AA Change: V1038L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: V1038L

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139199
Predicted Effect probably benign
Transcript: ENSMUST00000141722
AA Change: V1055L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: V1055L

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151435
Meta Mutation Damage Score 0.0806 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4930449A18Rik T A 3: 59,841,732 noncoding transcript Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamtsl3 C T 7: 82,528,861 R511C probably damaging Het
Arhgap11a T C 2: 113,839,762 S339G probably damaging Het
C2cd3 A G 7: 100,416,190 T728A probably benign Het
Cand1 C A 10: 119,213,546 probably null Het
Catspere1 A T 1: 177,872,058 noncoding transcript Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cdc16 A G 8: 13,781,644 probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Chrna7 A C 7: 63,212,448 L10R probably benign Het
Clnk C T 5: 38,713,069 probably null Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dennd2a T C 6: 39,497,110 D430G probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Eif2b1 A G 5: 124,576,908 S102P probably damaging Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fat3 A C 9: 15,997,587 V2373G probably damaging Het
Gadd45a A T 6: 67,036,889 L58Q probably damaging Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gldc T A 19: 30,133,732 N548I possibly damaging Het
Gm13035 A G 4: 146,073,423 noncoding transcript Het
Gm27013 T A 6: 130,520,737 noncoding transcript Het
Gm5436 A T 12: 84,258,810 noncoding transcript Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Hfm1 C A 5: 106,892,751 W716L probably damaging Het
Hist1h2bl C T 13: 21,716,064 probably benign Het
Il5ra T C 6: 106,738,375 Y166C probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kcnv2 A G 19: 27,323,790 D347G probably damaging Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Lamb1 C T 12: 31,287,433 H388Y probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lmbr1 G A 5: 29,287,426 T55I probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrp2 A T 2: 69,469,411 V3099E probably benign Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Map1a T A 2: 121,302,086 S890T probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myh7b C A 2: 155,633,989 L1935M probably benign Het
Myh9 T C 15: 77,769,253 E1348G probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nr1h3 A G 2: 91,190,218 F257L probably benign Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Olfr653 A T 7: 104,580,215 I190L probably benign Het
Pde1a T A 2: 80,128,837 probably benign Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pnkp C A 7: 44,861,646 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Ptk6 T G 2: 181,196,991 N323T possibly damaging Het
Rhox3c G A X: 37,470,424 A60T probably damaging Het
Rnf4 T A 5: 34,348,709 V61E probably damaging Het
Rnf5 A G 17: 34,602,003 probably benign Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sema5a C T 15: 32,609,417 H490Y probably benign Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stag3 T G 5: 138,309,365 probably null Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Tas2r116 G A 6: 132,855,697 S87N probably benign Het
Tomm6 T C 17: 47,688,069 probably benign Het
Trabd T C 15: 89,082,712 M113T probably benign Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vma21-ps T A 4: 52,496,943 D101V probably damaging Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9798187 missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9809130 missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9769410 missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9808504 missense probably benign
R7974:Stxbp5 UTSW 10 9770695 splice site probably null
R8009:Stxbp5 UTSW 10 9816302 missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9784385 missense probably benign
R8353:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9812259 critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9812289 missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9817306 missense probably null 0.98
R8805:Stxbp5 UTSW 10 9838115 nonsense probably null
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9900545 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTGACCAAGTGCCTGCATAC -3'
(R):5'- CCAAATTTCTGCTGTGTGATCTGG -3'

Sequencing Primer
(F):5'- AGTGCCTGCATACCTCATGAG -3'
(R):5'- AAAATGTTTAGAGTGGTGCACTG -3'
Posted On2016-03-01