Incidental Mutation 'R4842:Ttc41'
ID 371933
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
MMRRC Submission 042455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R4842 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86731125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 552 (R552C)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070435
SMART Domains Protein: ENSMUSP00000136633
Gene: ENSMUSG00000056366

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 6.5e-13 PFAM
Pfam:Lipocalin 6 132 2.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: R552C

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: R552C

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: R552C

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4930449A18Rik T A 3: 59,841,732 noncoding transcript Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamtsl3 C T 7: 82,528,861 R511C probably damaging Het
Arhgap11a T C 2: 113,839,762 S339G probably damaging Het
C2cd3 A G 7: 100,416,190 T728A probably benign Het
Cand1 C A 10: 119,213,546 probably null Het
Catspere1 A T 1: 177,872,058 noncoding transcript Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cdc16 A G 8: 13,781,644 probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Chrna7 A C 7: 63,212,448 L10R probably benign Het
Clnk C T 5: 38,713,069 probably null Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dennd2a T C 6: 39,497,110 D430G probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Eif2b1 A G 5: 124,576,908 S102P probably damaging Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fat3 A C 9: 15,997,587 V2373G probably damaging Het
Gadd45a A T 6: 67,036,889 L58Q probably damaging Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gldc T A 19: 30,133,732 N548I possibly damaging Het
Gm13035 A G 4: 146,073,423 noncoding transcript Het
Gm27013 T A 6: 130,520,737 noncoding transcript Het
Gm5436 A T 12: 84,258,810 noncoding transcript Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Hfm1 C A 5: 106,892,751 W716L probably damaging Het
Hist1h2bl C T 13: 21,716,064 probably benign Het
Il5ra T C 6: 106,738,375 Y166C probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kcnv2 A G 19: 27,323,790 D347G probably damaging Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Lamb1 C T 12: 31,287,433 H388Y probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lmbr1 G A 5: 29,287,426 T55I probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrp2 A T 2: 69,469,411 V3099E probably benign Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Map1a T A 2: 121,302,086 S890T probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myh7b C A 2: 155,633,989 L1935M probably benign Het
Myh9 T C 15: 77,769,253 E1348G probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nr1h3 A G 2: 91,190,218 F257L probably benign Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Olfr653 A T 7: 104,580,215 I190L probably benign Het
Pde1a T A 2: 80,128,837 probably benign Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pnkp C A 7: 44,861,646 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Ptk6 T G 2: 181,196,991 N323T possibly damaging Het
Rhox3c G A X: 37,470,424 A60T probably damaging Het
Rnf4 T A 5: 34,348,709 V61E probably damaging Het
Rnf5 A G 17: 34,602,003 probably benign Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sema5a C T 15: 32,609,417 H490Y probably benign Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stag3 T G 5: 138,309,365 probably null Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Tas2r116 G A 6: 132,855,697 S87N probably benign Het
Tomm6 T C 17: 47,688,069 probably benign Het
Trabd T C 15: 89,082,712 M113T probably benign Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vma21-ps T A 4: 52,496,943 D101V probably damaging Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGTCTGTCCTGCAAGTC -3'
(R):5'- GCCATAAAGGAGGCACTTTTAGG -3'

Sequencing Primer
(F):5'- CTGACGTGAAGATCGTGGAACTC -3'
(R):5'- GAGGCACTTTTAGGATCAGCTATCAC -3'
Posted On 2016-03-01