Mutagenetix > Incidental Mutation

Incidental Mutation 'R4842:Lamb1'

371942

Institutional Source

Beutler Lab

Gene Symbol

Lamb1

Ensembl Gene

ENSMUSG00000002900

Gene Name

laminin B1

Synonyms

C80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik

MMRRC Submission

042455-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4842 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31265234-31329644 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31287433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 388 (H388Y)

Ref Sequence

ENSEMBL: ENSMUSP00000002979 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]

AlphaFold

P02469

Predicted Effect

probably damaging
Transcript: ENSMUST00000002979
AA Change: H388Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: H388Y

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
LamNT	77	317	3.24e-96	SMART
EGF_Lam	319	380	1.34e-6	SMART
EGF_Lam	383	443	1.33e-10	SMART
EGF_Lam	446	503	2.89e-11	SMART
EGF_Lam	506	555	2.89e-11	SMART
EGF_Lam	558	602	3.4e-8	SMART
EGF_Lam	821	866	4.99e-15	SMART
EGF_Lam	869	912	2.38e-12	SMART
EGF_Lam	915	962	2.4e-8	SMART
EGF_Lam	965	1021	1.41e-5	SMART
EGF_Lam	1024	1073	4.81e-8	SMART
EGF_Lam	1076	1129	3.81e-11	SMART
EGF_Lam	1132	1177	5.61e-9	SMART
EGF_Lam	1180	1224	2.89e-11	SMART
coiled coil region	1329	1360	N/A	INTRINSIC
low complexity region	1468	1480	N/A	INTRINSIC
coiled coil region	1497	1551	N/A	INTRINSIC
coiled coil region	1600	1826	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164919
AA Change: H388Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132616
Gene: ENSMUSG00000002900
AA Change: H388Y

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
LamNT	77	317	3.24e-96	SMART
EGF_Lam	319	380	1.34e-6	SMART
EGF_Lam	383	443	1.33e-10	SMART
EGF_Lam	446	503	2.89e-11	SMART
EGF_Lam	506	555	2.89e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169065

Predicted Effect

probably damaging
Transcript: ENSMUST00000169088
AA Change: H340Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: H340Y

Domain	Start	End	E-Value	Type
LamNT	29	269	3.24e-96	SMART
EGF_Lam	271	332	1.34e-6	SMART
EGF_Lam	335	395	1.33e-10	SMART
EGF_Lam	398	455	2.89e-11	SMART
EGF_Lam	458	507	2.89e-11	SMART
EGF_Lam	510	554	3.4e-8	SMART
EGF_Lam	773	818	4.99e-15	SMART
EGF_Lam	821	864	2.38e-12	SMART
EGF_Lam	867	914	2.4e-8	SMART
EGF_Lam	917	973	1.41e-5	SMART
EGF_Lam	976	1025	4.81e-8	SMART
EGF_Lam	1028	1081	3.81e-11	SMART
EGF_Lam	1084	1129	5.61e-9	SMART
EGF_Lam	1132	1176	2.89e-11	SMART
coiled coil region	1281	1312	N/A	INTRINSIC
low complexity region	1420	1432	N/A	INTRINSIC
coiled coil region	1449	1503	N/A	INTRINSIC
coiled coil region	1552	1778	N/A	INTRINSIC

Meta Mutation Damage Score

0.4773

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

95% (107/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	A	T	17: 14,943,739	I43L	possibly damaging	Het
4930449A18Rik	T	A	3: 59,841,732		noncoding transcript	Het
9530053A07Rik	T	A	7: 28,150,722	C1198S	probably damaging	Het
Abcc8	T	C	7: 46,150,828	K510R	probably damaging	Het
Adamtsl3	C	T	7: 82,528,861	R511C	probably damaging	Het
Arhgap11a	T	C	2: 113,839,762	S339G	probably damaging	Het
C2cd3	A	G	7: 100,416,190	T728A	probably benign	Het
Cand1	C	A	10: 119,213,546		probably null	Het
Catspere1	A	T	1: 177,872,058		noncoding transcript	Het
Cd209c	G	T	8: 3,945,905	R2S	probably benign	Het
Cdc16	A	G	8: 13,781,644		probably benign	Het
Ces1g	C	T	8: 93,333,695	E99K	probably benign	Het
Chrna7	A	C	7: 63,212,448	L10R	probably benign	Het
Clnk	C	T	5: 38,713,069		probably null	Het
Cntrob	C	G	11: 69,315,394	L315F	possibly damaging	Het
Ctdp1	A	G	18: 80,408,726	S145P	unknown	Het
Dennd2a	T	C	6: 39,497,110	D430G	probably damaging	Het
Dnajc16	A	G	4: 141,774,625	F298S	probably damaging	Het
Dock5	T	C	14: 67,817,563	D618G	probably damaging	Het
Drc3	G	A	11: 60,370,535	A171T	probably benign	Het
Ecel1	A	T	1: 87,153,301	N322K	probably damaging	Het
Eftud2	A	G	11: 102,854,814	F362L	probably damaging	Het
Egfr	C	T	11: 16,911,607	H1129Y	probably benign	Het
Eif2b1	A	G	5: 124,576,908	S102P	probably damaging	Het
Erich3	T	A	3: 154,704,843	F112I	possibly damaging	Het
Fam107b	T	C	2: 3,778,543	L261S	probably damaging	Het
Fam198b	G	A	3: 79,936,605	R377H	probably damaging	Het
Fat3	A	C	9: 15,997,587	V2373G	probably damaging	Het
Gadd45a	A	T	6: 67,036,889	L58Q	probably damaging	Het
Gipr	C	T	7: 19,162,676	R165H	probably damaging	Het
Gje1	C	T	10: 14,717,338	G45R	probably null	Het
Gldc	T	A	19: 30,133,732	N548I	possibly damaging	Het
Gm13035	A	G	4: 146,073,423		noncoding transcript	Het
Gm27013	T	A	6: 130,520,737		noncoding transcript	Het
Gm5436	A	T	12: 84,258,810		noncoding transcript	Het
Gm6588	A	T	5: 112,450,240	K218*	probably null	Het
Grik3	C	A	4: 125,691,176	N612K	probably damaging	Het
Hfm1	C	A	5: 106,892,751	W716L	probably damaging	Het
Hist1h2bl	C	T	13: 21,716,064		probably benign	Het
Il5ra	T	C	6: 106,738,375	Y166C	probably damaging	Het
Iqcb1	A	G	16: 36,835,590	E113G	probably benign	Het
Kcnk10	A	T	12: 98,434,916	M486K	probably benign	Het
Kcnv2	A	G	19: 27,323,790	D347G	probably damaging	Het
Kif21b	C	A	1: 136,145,220	H119N	probably damaging	Het
Leng9	T	C	7: 4,149,386	D97G	probably damaging	Het
Lmbr1	G	A	5: 29,287,426	T55I	probably damaging	Het
Lrp1	G	T	10: 127,583,936	R935S	probably damaging	Het
Lrp2	A	T	2: 69,469,411	V3099E	probably benign	Het
Lrrcc1	C	A	3: 14,562,511	D503E	probably benign	Het
Map1a	T	A	2: 121,302,086	S890T	probably damaging	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mybph	A	T	1: 134,198,495	E349V	probably damaging	Het
Myh7b	C	A	2: 155,633,989	L1935M	probably benign	Het
Myh9	T	C	15: 77,769,253	E1348G	probably damaging	Het
Myzap	A	G	9: 71,548,755	S328P	probably damaging	Het
Nbeal1	T	C	1: 60,253,375	L1062P	probably damaging	Het
Nepro	G	A	16: 44,734,797	S412N	probably null	Het
Nr1h3	A	G	2: 91,190,218	F257L	probably benign	Het
Nudt5	T	C	2: 5,864,428	V155A	probably benign	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr522	A	G	7: 140,162,689	L87P	possibly damaging	Het
Olfr539	A	T	7: 140,667,589	I94F	probably damaging	Het
Olfr653	A	T	7: 104,580,215	I190L	probably benign	Het
Pde1a	T	A	2: 80,128,837		probably benign	Het
Pde4dip	T	A	3: 97,793,528	H220L	probably damaging	Het
Pde9a	T	A	17: 31,443,161		probably null	Het
Pnkp	C	A	7: 44,861,646		probably null	Het
Pnpla7	A	G	2: 24,980,052	T15A	probably benign	Het
Polq	G	T	16: 37,048,783		probably null	Het
Ppfia2	C	T	10: 106,854,957	T553I	probably benign	Het
Ptk6	T	G	2: 181,196,991	N323T	possibly damaging	Het
Rhox3c	G	A	X: 37,470,424	A60T	probably damaging	Het
Rnf4	T	A	5: 34,348,709	V61E	probably damaging	Het
Rnf5	A	G	17: 34,602,003		probably benign	Het
Sardh	A	G	2: 27,191,955	V853A	probably benign	Het
Scfd1	T	C	12: 51,389,326	V86A	probably damaging	Het
Scube3	G	A	17: 28,164,123	C425Y	probably damaging	Het
Sema5a	C	T	15: 32,609,417	H490Y	probably benign	Het
Sfta2	T	C	17: 35,649,881		probably benign	Het
Sh3d19	T	C	3: 86,123,742	Y738H	probably damaging	Het
Shc2	T	C	10: 79,622,461	R463G	probably damaging	Het
Socs7	T	A	11: 97,377,003	I320N	possibly damaging	Het
Speer2	A	T	16: 69,858,100	M159K	probably benign	Het
Sppl2c	A	C	11: 104,187,652	H426P	probably benign	Het
Stag3	T	G	5: 138,309,365		probably null	Het
Stxbp5	C	A	10: 9,762,891	V1055L	probably benign	Het
Synpo	A	T	18: 60,603,612	S421T	probably damaging	Het
Taf6l	A	G	19: 8,782,406	V135A	possibly damaging	Het
Tas2r116	G	A	6: 132,855,697	S87N	probably benign	Het
Tomm6	T	C	17: 47,688,069		probably benign	Het
Trabd	T	C	15: 89,082,712	M113T	probably benign	Het
Trim58	G	A	11: 58,651,324	G370E	probably damaging	Het
Ttc41	C	T	10: 86,731,125	R552C	probably benign	Het
Vit	T	C	17: 78,601,879	S252P	probably benign	Het
Vma21-ps	T	A	4: 52,496,943	D101V	probably damaging	Het
Vmn1r173	A	T	7: 23,702,936	I199F	probably damaging	Het
Vmn2r114	T	A	17: 23,310,362	R255S	probably benign	Het
Vmn2r17	A	G	5: 109,434,380	N545S	probably damaging	Het
Zfp865	A	G	7: 5,031,641	Y875C	probably damaging	Het

Other mutations in Lamb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Lamb1	APN	12	31298826	missense	possibly damaging	0.74
IGL00939:Lamb1	APN	12	31302927	missense	probably damaging	1.00
IGL01017:Lamb1	APN	12	31301064	missense	possibly damaging	0.89
IGL01384:Lamb1	APN	12	31320931	missense	probably benign	0.09
IGL01470:Lamb1	APN	12	31300262	missense	possibly damaging	0.55
IGL01554:Lamb1	APN	12	31306977	missense	probably damaging	1.00
IGL02207:Lamb1	APN	12	31329435	missense	probably damaging	1.00
IGL02271:Lamb1	APN	12	31300251	missense	probably damaging	1.00
IGL02272:Lamb1	APN	12	31305769	missense	probably benign	0.00
IGL02365:Lamb1	APN	12	31318345	missense	probably damaging	1.00
IGL02471:Lamb1	APN	12	31320908	missense	probably damaging	1.00
IGL02704:Lamb1	APN	12	31318467	missense	probably benign	0.05
IGL03132:Lamb1	APN	12	31300334	splice site	probably null
IGL03161:Lamb1	APN	12	31326256	missense	probably benign	0.41
IGL03169:Lamb1	APN	12	31323646	missense	probably damaging	1.00
Crush	UTSW	12	31287424	missense	probably damaging	1.00
Deflationary	UTSW	12	31321075	missense	probably null	0.63
E0374:Lamb1	UTSW	12	31287930	missense	probably damaging	1.00
P0043:Lamb1	UTSW	12	31278621	missense	probably damaging	1.00
R0031:Lamb1	UTSW	12	31301156	missense	probably benign	0.04
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0285:Lamb1	UTSW	12	31326645	nonsense	probably null
R0456:Lamb1	UTSW	12	31304730	missense	probably damaging	1.00
R0477:Lamb1	UTSW	12	31326269	missense	possibly damaging	0.47
R0480:Lamb1	UTSW	12	31282721	missense	possibly damaging	0.79
R0544:Lamb1	UTSW	12	31282695	missense	probably damaging	1.00
R0565:Lamb1	UTSW	12	31298915	missense	probably benign	0.02
R1500:Lamb1	UTSW	12	31298949	missense	possibly damaging	0.82
R1624:Lamb1	UTSW	12	31278652	critical splice donor site	probably null
R1772:Lamb1	UTSW	12	31278525	missense	probably damaging	1.00
R1836:Lamb1	UTSW	12	31301094	missense	probably benign	0.00
R1853:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1854:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1903:Lamb1	UTSW	12	31329210	missense	probably damaging	1.00
R2091:Lamb1	UTSW	12	31287429	missense	probably damaging	0.98
R2186:Lamb1	UTSW	12	31318467	nonsense	probably null
R2268:Lamb1	UTSW	12	31327645	missense	probably damaging	1.00
R2567:Lamb1	UTSW	12	31269055	critical splice acceptor site	probably null
R2698:Lamb1	UTSW	12	31298883	missense	probably benign	0.10
R3121:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3405:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3406:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3608:Lamb1	UTSW	12	31287910	missense	probably damaging	1.00
R3725:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3726:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3949:Lamb1	UTSW	12	31282649	missense	probably damaging	1.00
R4308:Lamb1	UTSW	12	31329255	missense	probably damaging	1.00
R4600:Lamb1	UTSW	12	31323529	missense	probably benign	0.00
R4604:Lamb1	UTSW	12	31278776	missense	probably damaging	1.00
R4701:Lamb1	UTSW	12	31266848	nonsense	probably null
R4710:Lamb1	UTSW	12	31282583	missense	probably benign	0.02
R4767:Lamb1	UTSW	12	31308011	missense	probably damaging	1.00
R4809:Lamb1	UTSW	12	31278526	missense	probably damaging	1.00
R4828:Lamb1	UTSW	12	31298930	missense	probably benign
R4864:Lamb1	UTSW	12	31321006	missense	probably benign	0.01
R4909:Lamb1	UTSW	12	31288281	missense	probably damaging	1.00
R4989:Lamb1	UTSW	12	31326678	missense	probably damaging	1.00
R5444:Lamb1	UTSW	12	31298909	missense	possibly damaging	0.47
R5736:Lamb1	UTSW	12	31302665	nonsense	probably null
R5766:Lamb1	UTSW	12	31299931	missense	probably damaging	1.00
R5825:Lamb1	UTSW	12	31318614	missense	probably benign
R5840:Lamb1	UTSW	12	31266756	missense	probably damaging	1.00
R5867:Lamb1	UTSW	12	31298955	missense	possibly damaging	0.82
R5887:Lamb1	UTSW	12	31266864	nonsense	probably null
R5984:Lamb1	UTSW	12	31327774	missense	possibly damaging	0.76
R6313:Lamb1	UTSW	12	31269147	missense	probably damaging	1.00
R6359:Lamb1	UTSW	12	31282716	missense	probably damaging	0.97
R6505:Lamb1	UTSW	12	31323462	missense	possibly damaging	0.63
R7127:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7202:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7271:Lamb1	UTSW	12	31287424	missense	probably damaging	1.00
R7290:Lamb1	UTSW	12	31265596	missense	probably benign	0.04
R7486:Lamb1	UTSW	12	31287442	missense	probably benign	0.00
R7496:Lamb1	UTSW	12	31300021	missense	probably benign	0.31
R7591:Lamb1	UTSW	12	31326648	missense	probably damaging	1.00
R7722:Lamb1	UTSW	12	31323571	missense	probably damaging	0.99
R7985:Lamb1	UTSW	12	31300215	missense	possibly damaging	0.93
R8058:Lamb1	UTSW	12	31303047	missense	probably benign	0.16
R8353:Lamb1	UTSW	12	31306999	missense	probably damaging	1.00
R8506:Lamb1	UTSW	12	31329361	missense	probably damaging	1.00
R8846:Lamb1	UTSW	12	31329389	missense	possibly damaging	0.75
R8888:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R8895:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R9312:Lamb1	UTSW	12	31318353	missense	probably damaging	1.00
R9340:Lamb1	UTSW	12	31324224	missense	probably benign
R9340:Lamb1	UTSW	12	31324225	missense	probably benign
R9371:Lamb1	UTSW	12	31298864	missense	probably damaging	0.98
R9417:Lamb1	UTSW	12	31287984	missense	probably damaging	1.00
R9562:Lamb1	UTSW	12	31272493	missense	probably damaging	1.00
R9626:Lamb1	UTSW	12	31304670	missense	probably benign
R9641:Lamb1	UTSW	12	31287458	missense	probably damaging	0.97
X0054:Lamb1	UTSW	12	31287434	missense	probably damaging	1.00
X0064:Lamb1	UTSW	12	31303042	missense	probably benign	0.35
Z1176:Lamb1	UTSW	12	31327702	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- TCATCACCAGAGGCTTCTTGC -3'
(R):5'- ATCCTGCGTGAGAAGTGAAG -3'

Sequencing Primer
(F):5'- GCTGTTTGACTCACACACAC -3'
(R):5'- TTCCCGACGTACGTTCACAGAG -3'

Posted On

2016-03-01