Incidental Mutation 'R4842:Lamb1'
ID 371942
Institutional Source Beutler Lab
Gene Symbol Lamb1
Ensembl Gene ENSMUSG00000002900
Gene Name laminin B1
Synonyms Lamb-1, D130003D08Rik, C80098, C81607, Lamb1-1
MMRRC Submission 042455-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4842 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 31315233-31379643 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31337432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 388 (H388Y)
Ref Sequence ENSEMBL: ENSMUSP00000002979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]
AlphaFold P02469
Predicted Effect probably damaging
Transcript: ENSMUST00000002979
AA Change: H388Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: H388Y

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164919
AA Change: H388Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132616
Gene: ENSMUSG00000002900
AA Change: H388Y

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169065
Predicted Effect probably damaging
Transcript: ENSMUST00000169088
AA Change: H340Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: H340Y

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Meta Mutation Damage Score 0.4773 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 15,164,001 (GRCm39) I43L possibly damaging Het
4930449A18Rik T A 3: 59,749,153 (GRCm39) noncoding transcript Het
Abcc8 T C 7: 45,800,252 (GRCm39) K510R probably damaging Het
Adamtsl3 C T 7: 82,178,069 (GRCm39) R511C probably damaging Het
Arhgap11a T C 2: 113,670,107 (GRCm39) S339G probably damaging Het
C2cd3 A G 7: 100,065,397 (GRCm39) T728A probably benign Het
Cand1 C A 10: 119,049,451 (GRCm39) probably null Het
Catspere1 A T 1: 177,699,624 (GRCm39) noncoding transcript Het
Ccdc121rt2 A T 5: 112,598,106 (GRCm39) K218* probably null Het
Cd209c G T 8: 3,995,905 (GRCm39) R2S probably benign Het
Cdc16 A G 8: 13,831,644 (GRCm39) probably benign Het
Ces1g C T 8: 94,060,323 (GRCm39) E99K probably benign Het
Chrna7 A C 7: 62,862,196 (GRCm39) L10R probably benign Het
Clnk C T 5: 38,870,412 (GRCm39) probably null Het
Cntrob C G 11: 69,206,220 (GRCm39) L315F possibly damaging Het
Ctdp1 A G 18: 80,451,941 (GRCm39) S145P unknown Het
Dennd2a T C 6: 39,474,044 (GRCm39) D430G probably damaging Het
Dnajc16 A G 4: 141,501,936 (GRCm39) F298S probably damaging Het
Dock5 T C 14: 68,055,012 (GRCm39) D618G probably damaging Het
Drc3 G A 11: 60,261,361 (GRCm39) A171T probably benign Het
Ecel1 A T 1: 87,081,023 (GRCm39) N322K probably damaging Het
Eftud2 A G 11: 102,745,640 (GRCm39) F362L probably damaging Het
Egfr C T 11: 16,861,607 (GRCm39) H1129Y probably benign Het
Eif2b1 A G 5: 124,714,971 (GRCm39) S102P probably damaging Het
Erich3 T A 3: 154,410,480 (GRCm39) F112I possibly damaging Het
Fam107b T C 2: 3,779,580 (GRCm39) L261S probably damaging Het
Fat3 A C 9: 15,908,883 (GRCm39) V2373G probably damaging Het
Fcgbpl1 T A 7: 27,850,147 (GRCm39) C1198S probably damaging Het
Gadd45a A T 6: 67,013,873 (GRCm39) L58Q probably damaging Het
Gask1b G A 3: 79,843,912 (GRCm39) R377H probably damaging Het
Gipr C T 7: 18,896,601 (GRCm39) R165H probably damaging Het
Gje1 C T 10: 14,593,082 (GRCm39) G45R probably null Het
Gldc T A 19: 30,111,132 (GRCm39) N548I possibly damaging Het
Gm13035 A G 4: 146,009,993 (GRCm39) noncoding transcript Het
Gm27013 T A 6: 130,497,700 (GRCm39) noncoding transcript Het
Gm5436 A T 12: 84,305,584 (GRCm39) noncoding transcript Het
Grik3 C A 4: 125,584,969 (GRCm39) N612K probably damaging Het
H2bc13 C T 13: 21,900,234 (GRCm39) probably benign Het
Hfm1 C A 5: 107,040,617 (GRCm39) W716L probably damaging Het
Il5ra T C 6: 106,715,336 (GRCm39) Y166C probably damaging Het
Iqcb1 A G 16: 36,655,952 (GRCm39) E113G probably benign Het
Kcnk10 A T 12: 98,401,175 (GRCm39) M486K probably benign Het
Kcnv2 A G 19: 27,301,190 (GRCm39) D347G probably damaging Het
Kif21b C A 1: 136,072,958 (GRCm39) H119N probably damaging Het
Leng9 T C 7: 4,152,385 (GRCm39) D97G probably damaging Het
Lmbr1 G A 5: 29,492,424 (GRCm39) T55I probably damaging Het
Lrp1 G T 10: 127,419,805 (GRCm39) R935S probably damaging Het
Lrp2 A T 2: 69,299,755 (GRCm39) V3099E probably benign Het
Lrrcc1 C A 3: 14,627,571 (GRCm39) D503E probably benign Het
Map1a T A 2: 121,132,567 (GRCm39) S890T probably damaging Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Mybph A T 1: 134,126,233 (GRCm39) E349V probably damaging Het
Myh7b C A 2: 155,475,909 (GRCm39) L1935M probably benign Het
Myh9 T C 15: 77,653,453 (GRCm39) E1348G probably damaging Het
Myzap A G 9: 71,456,037 (GRCm39) S328P probably damaging Het
Nbeal1 T C 1: 60,292,534 (GRCm39) L1062P probably damaging Het
Nepro G A 16: 44,555,160 (GRCm39) S412N probably null Het
Nr1h3 A G 2: 91,020,563 (GRCm39) F257L probably benign Het
Nudt5 T C 2: 5,869,239 (GRCm39) V155A probably benign Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or13a25 A T 7: 140,247,502 (GRCm39) I94F probably damaging Het
Or52d3 A T 7: 104,229,422 (GRCm39) I190L probably benign Het
Or6ae1 A G 7: 139,742,602 (GRCm39) L87P possibly damaging Het
Pde1a T A 2: 79,959,181 (GRCm39) probably benign Het
Pde4dip T A 3: 97,700,844 (GRCm39) H220L probably damaging Het
Pde9a T A 17: 31,662,135 (GRCm39) probably null Het
Pnkp C A 7: 44,511,070 (GRCm39) probably null Het
Pnpla7 A G 2: 24,870,064 (GRCm39) T15A probably benign Het
Polq G T 16: 36,869,145 (GRCm39) probably null Het
Ppfia2 C T 10: 106,690,818 (GRCm39) T553I probably benign Het
Ptk6 T G 2: 180,838,784 (GRCm39) N323T possibly damaging Het
Rhox3c G A X: 36,652,077 (GRCm39) A60T probably damaging Het
Rnf4 T A 5: 34,506,053 (GRCm39) V61E probably damaging Het
Rnf5 A G 17: 34,820,977 (GRCm39) probably benign Het
Sardh A G 2: 27,081,967 (GRCm39) V853A probably benign Het
Scfd1 T C 12: 51,436,109 (GRCm39) V86A probably damaging Het
Scube3 G A 17: 28,383,097 (GRCm39) C425Y probably damaging Het
Sema5a C T 15: 32,609,563 (GRCm39) H490Y probably benign Het
Sfta2 T C 17: 35,960,773 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,031,049 (GRCm39) Y738H probably damaging Het
Shc2 T C 10: 79,458,295 (GRCm39) R463G probably damaging Het
Socs7 T A 11: 97,267,829 (GRCm39) I320N possibly damaging Het
Speer2 A T 16: 69,654,988 (GRCm39) M159K probably benign Het
Sppl2c A C 11: 104,078,478 (GRCm39) H426P probably benign Het
Stag3 T G 5: 138,307,627 (GRCm39) probably null Het
Stxbp5 C A 10: 9,638,635 (GRCm39) V1055L probably benign Het
Synpo A T 18: 60,736,684 (GRCm39) S421T probably damaging Het
Taf6l A G 19: 8,759,770 (GRCm39) V135A possibly damaging Het
Tas2r116 G A 6: 132,832,660 (GRCm39) S87N probably benign Het
Tomm6 T C 17: 47,998,994 (GRCm39) probably benign Het
Trabd T C 15: 88,966,915 (GRCm39) M113T probably benign Het
Trim58 G A 11: 58,542,150 (GRCm39) G370E probably damaging Het
Ttc41 C T 10: 86,566,989 (GRCm39) R552C probably benign Het
Vit T C 17: 78,909,308 (GRCm39) S252P probably benign Het
Vma21-ps T A 4: 52,496,943 (GRCm39) D101V probably damaging Het
Vmn1r173 A T 7: 23,402,361 (GRCm39) I199F probably damaging Het
Vmn2r114 T A 17: 23,529,336 (GRCm39) R255S probably benign Het
Vmn2r17 A G 5: 109,582,246 (GRCm39) N545S probably damaging Het
Zfp865 A G 7: 5,034,640 (GRCm39) Y875C probably damaging Het
Other mutations in Lamb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Lamb1 APN 12 31,348,825 (GRCm39) missense possibly damaging 0.74
IGL00939:Lamb1 APN 12 31,352,926 (GRCm39) missense probably damaging 1.00
IGL01017:Lamb1 APN 12 31,351,063 (GRCm39) missense possibly damaging 0.89
IGL01384:Lamb1 APN 12 31,370,930 (GRCm39) missense probably benign 0.09
IGL01470:Lamb1 APN 12 31,350,261 (GRCm39) missense possibly damaging 0.55
IGL01554:Lamb1 APN 12 31,356,976 (GRCm39) missense probably damaging 1.00
IGL02207:Lamb1 APN 12 31,379,434 (GRCm39) missense probably damaging 1.00
IGL02271:Lamb1 APN 12 31,350,250 (GRCm39) missense probably damaging 1.00
IGL02272:Lamb1 APN 12 31,355,768 (GRCm39) missense probably benign 0.00
IGL02365:Lamb1 APN 12 31,368,344 (GRCm39) missense probably damaging 1.00
IGL02471:Lamb1 APN 12 31,370,907 (GRCm39) missense probably damaging 1.00
IGL02704:Lamb1 APN 12 31,368,466 (GRCm39) missense probably benign 0.05
IGL03132:Lamb1 APN 12 31,350,333 (GRCm39) splice site probably null
IGL03161:Lamb1 APN 12 31,376,255 (GRCm39) missense probably benign 0.41
IGL03169:Lamb1 APN 12 31,373,645 (GRCm39) missense probably damaging 1.00
Crush UTSW 12 31,337,423 (GRCm39) missense probably damaging 1.00
Deflationary UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
E0374:Lamb1 UTSW 12 31,337,929 (GRCm39) missense probably damaging 1.00
P0043:Lamb1 UTSW 12 31,328,620 (GRCm39) missense probably damaging 1.00
R0031:Lamb1 UTSW 12 31,351,155 (GRCm39) missense probably benign 0.04
R0047:Lamb1 UTSW 12 31,328,600 (GRCm39) missense possibly damaging 0.51
R0047:Lamb1 UTSW 12 31,328,600 (GRCm39) missense possibly damaging 0.51
R0285:Lamb1 UTSW 12 31,376,644 (GRCm39) nonsense probably null
R0456:Lamb1 UTSW 12 31,354,729 (GRCm39) missense probably damaging 1.00
R0477:Lamb1 UTSW 12 31,376,268 (GRCm39) missense possibly damaging 0.47
R0480:Lamb1 UTSW 12 31,332,720 (GRCm39) missense possibly damaging 0.79
R0544:Lamb1 UTSW 12 31,332,694 (GRCm39) missense probably damaging 1.00
R0565:Lamb1 UTSW 12 31,348,914 (GRCm39) missense probably benign 0.02
R1500:Lamb1 UTSW 12 31,348,948 (GRCm39) missense possibly damaging 0.82
R1624:Lamb1 UTSW 12 31,328,651 (GRCm39) critical splice donor site probably null
R1772:Lamb1 UTSW 12 31,328,524 (GRCm39) missense probably damaging 1.00
R1836:Lamb1 UTSW 12 31,351,093 (GRCm39) missense probably benign 0.00
R1853:Lamb1 UTSW 12 31,368,271 (GRCm39) missense probably damaging 1.00
R1854:Lamb1 UTSW 12 31,368,271 (GRCm39) missense probably damaging 1.00
R1903:Lamb1 UTSW 12 31,379,209 (GRCm39) missense probably damaging 1.00
R2091:Lamb1 UTSW 12 31,337,428 (GRCm39) missense probably damaging 0.98
R2186:Lamb1 UTSW 12 31,368,466 (GRCm39) nonsense probably null
R2268:Lamb1 UTSW 12 31,377,644 (GRCm39) missense probably damaging 1.00
R2567:Lamb1 UTSW 12 31,319,054 (GRCm39) critical splice acceptor site probably null
R2698:Lamb1 UTSW 12 31,348,882 (GRCm39) missense probably benign 0.10
R3121:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3405:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3406:Lamb1 UTSW 12 31,337,528 (GRCm39) missense probably damaging 1.00
R3608:Lamb1 UTSW 12 31,337,909 (GRCm39) missense probably damaging 1.00
R3725:Lamb1 UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
R3726:Lamb1 UTSW 12 31,371,074 (GRCm39) missense probably null 0.63
R3949:Lamb1 UTSW 12 31,332,648 (GRCm39) missense probably damaging 1.00
R4308:Lamb1 UTSW 12 31,379,254 (GRCm39) missense probably damaging 1.00
R4600:Lamb1 UTSW 12 31,373,528 (GRCm39) missense probably benign 0.00
R4604:Lamb1 UTSW 12 31,328,775 (GRCm39) missense probably damaging 1.00
R4701:Lamb1 UTSW 12 31,316,847 (GRCm39) nonsense probably null
R4710:Lamb1 UTSW 12 31,332,582 (GRCm39) missense probably benign 0.02
R4767:Lamb1 UTSW 12 31,358,010 (GRCm39) missense probably damaging 1.00
R4809:Lamb1 UTSW 12 31,328,525 (GRCm39) missense probably damaging 1.00
R4828:Lamb1 UTSW 12 31,348,929 (GRCm39) missense probably benign
R4864:Lamb1 UTSW 12 31,371,005 (GRCm39) missense probably benign 0.01
R4909:Lamb1 UTSW 12 31,338,280 (GRCm39) missense probably damaging 1.00
R4989:Lamb1 UTSW 12 31,376,677 (GRCm39) missense probably damaging 1.00
R5444:Lamb1 UTSW 12 31,348,908 (GRCm39) missense possibly damaging 0.47
R5736:Lamb1 UTSW 12 31,352,664 (GRCm39) nonsense probably null
R5766:Lamb1 UTSW 12 31,349,930 (GRCm39) missense probably damaging 1.00
R5825:Lamb1 UTSW 12 31,368,613 (GRCm39) missense probably benign
R5840:Lamb1 UTSW 12 31,316,755 (GRCm39) missense probably damaging 1.00
R5867:Lamb1 UTSW 12 31,348,954 (GRCm39) missense possibly damaging 0.82
R5887:Lamb1 UTSW 12 31,316,863 (GRCm39) nonsense probably null
R5984:Lamb1 UTSW 12 31,377,773 (GRCm39) missense possibly damaging 0.76
R6313:Lamb1 UTSW 12 31,319,146 (GRCm39) missense probably damaging 1.00
R6359:Lamb1 UTSW 12 31,332,715 (GRCm39) missense probably damaging 0.97
R6505:Lamb1 UTSW 12 31,373,461 (GRCm39) missense possibly damaging 0.63
R7127:Lamb1 UTSW 12 31,374,314 (GRCm39) missense probably damaging 1.00
R7202:Lamb1 UTSW 12 31,374,314 (GRCm39) missense probably damaging 1.00
R7271:Lamb1 UTSW 12 31,337,423 (GRCm39) missense probably damaging 1.00
R7290:Lamb1 UTSW 12 31,315,595 (GRCm39) missense probably benign 0.04
R7486:Lamb1 UTSW 12 31,337,441 (GRCm39) missense probably benign 0.00
R7496:Lamb1 UTSW 12 31,350,020 (GRCm39) missense probably benign 0.31
R7591:Lamb1 UTSW 12 31,376,647 (GRCm39) missense probably damaging 1.00
R7722:Lamb1 UTSW 12 31,373,570 (GRCm39) missense probably damaging 0.99
R7985:Lamb1 UTSW 12 31,350,214 (GRCm39) missense possibly damaging 0.93
R8058:Lamb1 UTSW 12 31,353,046 (GRCm39) missense probably benign 0.16
R8353:Lamb1 UTSW 12 31,356,998 (GRCm39) missense probably damaging 1.00
R8506:Lamb1 UTSW 12 31,379,360 (GRCm39) missense probably damaging 1.00
R8846:Lamb1 UTSW 12 31,379,388 (GRCm39) missense possibly damaging 0.75
R8888:Lamb1 UTSW 12 31,352,953 (GRCm39) missense possibly damaging 0.95
R8895:Lamb1 UTSW 12 31,352,953 (GRCm39) missense possibly damaging 0.95
R9312:Lamb1 UTSW 12 31,368,352 (GRCm39) missense probably damaging 1.00
R9340:Lamb1 UTSW 12 31,374,224 (GRCm39) missense probably benign
R9340:Lamb1 UTSW 12 31,374,223 (GRCm39) missense probably benign
R9371:Lamb1 UTSW 12 31,348,863 (GRCm39) missense probably damaging 0.98
R9417:Lamb1 UTSW 12 31,337,983 (GRCm39) missense probably damaging 1.00
R9562:Lamb1 UTSW 12 31,322,492 (GRCm39) missense probably damaging 1.00
R9626:Lamb1 UTSW 12 31,354,669 (GRCm39) missense probably benign
R9641:Lamb1 UTSW 12 31,337,457 (GRCm39) missense probably damaging 0.97
X0054:Lamb1 UTSW 12 31,337,433 (GRCm39) missense probably damaging 1.00
X0064:Lamb1 UTSW 12 31,353,041 (GRCm39) missense probably benign 0.35
Z1176:Lamb1 UTSW 12 31,377,701 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCATCACCAGAGGCTTCTTGC -3'
(R):5'- ATCCTGCGTGAGAAGTGAAG -3'

Sequencing Primer
(F):5'- GCTGTTTGACTCACACACAC -3'
(R):5'- TTCCCGACGTACGTTCACAGAG -3'
Posted On 2016-03-01