Incidental Mutation 'R4842:Kcnv2'
ID371967
Institutional Source Beutler Lab
Gene Symbol Kcnv2
Ensembl Gene ENSMUSG00000047298
Gene Namepotassium channel, subfamily V, member 2
SynonymsKV11.1
MMRRC Submission 042455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4842 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location27322588-27337179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27323790 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 347 (D347G)
Ref Sequence ENSEMBL: ENSMUSP00000055091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056708]
Predicted Effect probably damaging
Transcript: ENSMUST00000056708
AA Change: D347G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055091
Gene: ENSMUSG00000047298
AA Change: D347G

DomainStartEndE-ValueType
low complexity region 64 79 N/A INTRINSIC
Pfam:BTB_2 107 206 3.1e-22 PFAM
low complexity region 225 240 N/A INTRINSIC
Pfam:Ion_trans 269 521 2.2e-39 PFAM
Pfam:PKD_channel 305 516 2.5e-7 PFAM
Pfam:Ion_trans_2 430 515 2.2e-15 PFAM
Meta Mutation Damage Score 0.9627 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 95% (107/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This member is identified as a 'silent subunit', and it does not form homomultimers, but forms heteromultimers with several other subfamily members. Through obligatory heteromerization, it exerts a function-altering effect on other potassium channel subunits. This protein is strongly expressed in pancreas and has a weaker expression in several other tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional ready allele are viable, fertile, and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik A T 17: 14,943,739 I43L possibly damaging Het
4930449A18Rik T A 3: 59,841,732 noncoding transcript Het
9530053A07Rik T A 7: 28,150,722 C1198S probably damaging Het
Abcc8 T C 7: 46,150,828 K510R probably damaging Het
Adamtsl3 C T 7: 82,528,861 R511C probably damaging Het
Arhgap11a T C 2: 113,839,762 S339G probably damaging Het
C2cd3 A G 7: 100,416,190 T728A probably benign Het
Cand1 C A 10: 119,213,546 probably null Het
Catspere1 A T 1: 177,872,058 noncoding transcript Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cdc16 A G 8: 13,781,644 probably benign Het
Ces1g C T 8: 93,333,695 E99K probably benign Het
Chrna7 A C 7: 63,212,448 L10R probably benign Het
Clnk C T 5: 38,713,069 probably null Het
Cntrob C G 11: 69,315,394 L315F possibly damaging Het
Ctdp1 A G 18: 80,408,726 S145P unknown Het
Dennd2a T C 6: 39,497,110 D430G probably damaging Het
Dnajc16 A G 4: 141,774,625 F298S probably damaging Het
Dock5 T C 14: 67,817,563 D618G probably damaging Het
Drc3 G A 11: 60,370,535 A171T probably benign Het
Ecel1 A T 1: 87,153,301 N322K probably damaging Het
Eftud2 A G 11: 102,854,814 F362L probably damaging Het
Egfr C T 11: 16,911,607 H1129Y probably benign Het
Eif2b1 A G 5: 124,576,908 S102P probably damaging Het
Erich3 T A 3: 154,704,843 F112I possibly damaging Het
Fam107b T C 2: 3,778,543 L261S probably damaging Het
Fam198b G A 3: 79,936,605 R377H probably damaging Het
Fat3 A C 9: 15,997,587 V2373G probably damaging Het
Gadd45a A T 6: 67,036,889 L58Q probably damaging Het
Gipr C T 7: 19,162,676 R165H probably damaging Het
Gje1 C T 10: 14,717,338 G45R probably null Het
Gldc T A 19: 30,133,732 N548I possibly damaging Het
Gm13035 A G 4: 146,073,423 noncoding transcript Het
Gm27013 T A 6: 130,520,737 noncoding transcript Het
Gm5436 A T 12: 84,258,810 noncoding transcript Het
Gm6588 A T 5: 112,450,240 K218* probably null Het
Grik3 C A 4: 125,691,176 N612K probably damaging Het
Hfm1 C A 5: 106,892,751 W716L probably damaging Het
Hist1h2bl C T 13: 21,716,064 probably benign Het
Il5ra T C 6: 106,738,375 Y166C probably damaging Het
Iqcb1 A G 16: 36,835,590 E113G probably benign Het
Kcnk10 A T 12: 98,434,916 M486K probably benign Het
Kif21b C A 1: 136,145,220 H119N probably damaging Het
Lamb1 C T 12: 31,287,433 H388Y probably damaging Het
Leng9 T C 7: 4,149,386 D97G probably damaging Het
Lmbr1 G A 5: 29,287,426 T55I probably damaging Het
Lrp1 G T 10: 127,583,936 R935S probably damaging Het
Lrp2 A T 2: 69,469,411 V3099E probably benign Het
Lrrcc1 C A 3: 14,562,511 D503E probably benign Het
Map1a T A 2: 121,302,086 S890T probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mybph A T 1: 134,198,495 E349V probably damaging Het
Myh7b C A 2: 155,633,989 L1935M probably benign Het
Myh9 T C 15: 77,769,253 E1348G probably damaging Het
Myzap A G 9: 71,548,755 S328P probably damaging Het
Nbeal1 T C 1: 60,253,375 L1062P probably damaging Het
Nepro G A 16: 44,734,797 S412N probably null Het
Nr1h3 A G 2: 91,190,218 F257L probably benign Het
Nudt5 T C 2: 5,864,428 V155A probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr522 A G 7: 140,162,689 L87P possibly damaging Het
Olfr539 A T 7: 140,667,589 I94F probably damaging Het
Olfr653 A T 7: 104,580,215 I190L probably benign Het
Pde1a T A 2: 80,128,837 probably benign Het
Pde4dip T A 3: 97,793,528 H220L probably damaging Het
Pde9a T A 17: 31,443,161 probably null Het
Pnkp C A 7: 44,861,646 probably null Het
Pnpla7 A G 2: 24,980,052 T15A probably benign Het
Polq G T 16: 37,048,783 probably null Het
Ppfia2 C T 10: 106,854,957 T553I probably benign Het
Ptk6 T G 2: 181,196,991 N323T possibly damaging Het
Rhox3c G A X: 37,470,424 A60T probably damaging Het
Rnf4 T A 5: 34,348,709 V61E probably damaging Het
Rnf5 A G 17: 34,602,003 probably benign Het
Sardh A G 2: 27,191,955 V853A probably benign Het
Scfd1 T C 12: 51,389,326 V86A probably damaging Het
Scube3 G A 17: 28,164,123 C425Y probably damaging Het
Sema5a C T 15: 32,609,417 H490Y probably benign Het
Sfta2 T C 17: 35,649,881 probably benign Het
Sh3d19 T C 3: 86,123,742 Y738H probably damaging Het
Shc2 T C 10: 79,622,461 R463G probably damaging Het
Socs7 T A 11: 97,377,003 I320N possibly damaging Het
Speer2 A T 16: 69,858,100 M159K probably benign Het
Sppl2c A C 11: 104,187,652 H426P probably benign Het
Stag3 T G 5: 138,309,365 probably null Het
Stxbp5 C A 10: 9,762,891 V1055L probably benign Het
Synpo A T 18: 60,603,612 S421T probably damaging Het
Taf6l A G 19: 8,782,406 V135A possibly damaging Het
Tas2r116 G A 6: 132,855,697 S87N probably benign Het
Tomm6 T C 17: 47,688,069 probably benign Het
Trabd T C 15: 89,082,712 M113T probably benign Het
Trim58 G A 11: 58,651,324 G370E probably damaging Het
Ttc41 C T 10: 86,731,125 R552C probably benign Het
Vit T C 17: 78,601,879 S252P probably benign Het
Vma21-ps T A 4: 52,496,943 D101V probably damaging Het
Vmn1r173 A T 7: 23,702,936 I199F probably damaging Het
Vmn2r114 T A 17: 23,310,362 R255S probably benign Het
Vmn2r17 A G 5: 109,434,380 N545S probably damaging Het
Zfp865 A G 7: 5,031,641 Y875C probably damaging Het
Other mutations in Kcnv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Kcnv2 APN 19 27323966 missense probably damaging 1.00
R0104:Kcnv2 UTSW 19 27323219 missense probably damaging 0.98
R0319:Kcnv2 UTSW 19 27324024 missense probably benign 0.25
R2852:Kcnv2 UTSW 19 27323096 missense probably benign 0.13
R4578:Kcnv2 UTSW 19 27323594 missense probably benign 0.01
R4702:Kcnv2 UTSW 19 27323567 missense probably damaging 1.00
R4935:Kcnv2 UTSW 19 27322932 missense probably damaging 1.00
R6305:Kcnv2 UTSW 19 27323837 missense probably benign 0.01
R6577:Kcnv2 UTSW 19 27324020 missense possibly damaging 0.46
R6974:Kcnv2 UTSW 19 27333882 missense probably benign
R7113:Kcnv2 UTSW 19 27324048 missense probably damaging 1.00
R7289:Kcnv2 UTSW 19 27333684 missense probably damaging 1.00
R7838:Kcnv2 UTSW 19 27322932 missense probably damaging 1.00
R7936:Kcnv2 UTSW 19 27322767 missense probably benign 0.04
R8528:Kcnv2 UTSW 19 27322987 missense probably benign 0.00
R8854:Kcnv2 UTSW 19 27333858 missense probably benign 0.01
Z1176:Kcnv2 UTSW 19 27323438 missense probably benign 0.11
Z1177:Kcnv2 UTSW 19 27323241 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGCCCTTTTCCTCTGTGG -3'
(R):5'- ATTCGGAAGATGCGCATGAG -3'

Sequencing Primer
(F):5'- CGTGCTCATCTCCGTGGTG -3'
(R):5'- GTCTCCAGGTCGTGTTCT -3'
Posted On2016-03-01