Incidental Mutation 'R4843:Zxdc'
ID371985
Institutional Source Beutler Lab
Gene Symbol Zxdc
Ensembl Gene ENSMUSG00000034430
Gene NameZXD family zinc finger C
SynonymsB930086F11Rik
MMRRC Submission 042456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4843 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location90369492-90403490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90382272 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 629 (T629A)
Ref Sequence ENSEMBL: ENSMUSP00000109167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045740] [ENSMUST00000075117] [ENSMUST00000113539]
Predicted Effect probably benign
Transcript: ENSMUST00000045740
SMART Domains Protein: ENSMUSP00000036329
Gene: ENSMUSG00000034430

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075117
AA Change: T629A

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430
AA Change: T629A

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113539
AA Change: T629A

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109167
Gene: ENSMUSG00000034430
AA Change: T629A

DomainStartEndE-ValueType
low complexity region 44 95 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
ZnF_C2H2 198 222 4.79e-3 SMART
ZnF_C2H2 231 255 4.3e-5 SMART
ZnF_C2H2 261 285 4.3e-5 SMART
ZnF_C2H2 291 313 1.69e-3 SMART
ZnF_C2H2 320 344 1.82e-3 SMART
ZnF_C2H2 351 375 1.26e-2 SMART
ZnF_C2H2 381 405 1.36e-2 SMART
ZnF_C2H2 411 435 5.21e-4 SMART
ZnF_C2H2 441 465 4.72e-2 SMART
ZnF_C2H2 474 499 3.07e-1 SMART
low complexity region 509 524 N/A INTRINSIC
low complexity region 657 673 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203368
Predicted Effect unknown
Transcript: ENSMUST00000203493
AA Change: T68A
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp1 T A 12: 30,896,145 K124* probably null Het
Actl11 G T 9: 107,929,492 C338F possibly damaging Het
Adam5 G A 8: 24,813,536 S125F probably damaging Het
Ap2s1 C A 7: 16,743,346 A44D possibly damaging Het
AW554918 T C 18: 25,340,000 V84A probably benign Het
Bsn G A 9: 108,107,189 T3222M unknown Het
Car15 A G 16: 17,836,608 Y155H possibly damaging Het
Cdca2 G T 14: 67,676,976 P945T probably damaging Het
Cdh16 A G 8: 104,621,540 F182L probably damaging Het
Cers6 G A 2: 69,068,659 A214T probably benign Het
Ces1g A T 8: 93,331,265 M136K probably damaging Het
Cnppd1 A G 1: 75,136,442 V394A probably benign Het
Cyp3a59 A T 5: 146,096,261 I148F possibly damaging Het
Dnah1 G A 14: 31,264,963 A3624V probably damaging Het
Exoc3l4 T C 12: 111,428,053 probably benign Het
Fap G T 2: 62,544,374 P227Q probably damaging Het
Fbxw10 G A 11: 62,847,325 R15H possibly damaging Het
Gm11011 T C 2: 169,587,320 probably benign Het
Gm11146 A C 16: 77,595,256 probably benign Het
Grip1 G A 10: 119,930,015 R84Q probably damaging Het
Hipk2 A G 6: 38,819,257 C19R possibly damaging Het
Hmgcll1 A G 9: 76,072,634 D102G possibly damaging Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kank1 T G 19: 25,431,007 S1283R probably damaging Het
Kcnip1 T A 11: 33,644,504 H95L probably benign Het
L3mbtl3 A T 10: 26,331,879 L314Q unknown Het
Marveld3 C A 8: 109,962,070 R13L possibly damaging Het
Mtrf1l G T 10: 5,823,696 P23Q possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr494 G A 7: 108,368,143 A218T probably benign Het
Olfr786 G T 10: 129,437,447 V212L probably benign Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Plod3 G A 5: 136,991,000 W428* probably null Het
Pnisr T A 4: 21,857,400 probably benign Het
Ppip5k1 C A 2: 121,326,887 R1046L probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prmt5 A T 14: 54,516,125 I99N probably benign Het
Ripk2 T C 4: 16,155,073 T149A probably damaging Het
Rpf2 C A 10: 40,247,002 probably benign Het
Rtf1 T A 2: 119,705,536 D190E possibly damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Snd1 T G 6: 28,668,643 V443G probably damaging Het
Spag9 T C 11: 94,097,818 F555L probably damaging Het
Srfbp1 A G 18: 52,488,677 K270R probably benign Het
Tenm2 T A 11: 36,024,020 N2230I probably damaging Het
Tmem106a T C 11: 101,586,195 probably benign Het
Tpsg1 A T 17: 25,370,617 probably benign Het
Trank1 A G 9: 111,366,078 S1057G probably benign Het
Unc13d G A 11: 116,074,259 T220M probably damaging Het
Vmn1r68 T C 7: 10,527,977 T65A probably benign Het
Vps50 T C 6: 3,536,974 probably null Het
Washc5 A G 15: 59,350,371 I85T possibly damaging Het
Zfp677 C T 17: 21,392,526 T2I probably benign Het
Other mutations in Zxdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Zxdc APN 6 90373779 missense probably damaging 1.00
IGL01943:Zxdc APN 6 90372538 intron probably benign
IGL02406:Zxdc APN 6 90398836 missense probably benign 0.00
IGL02596:Zxdc APN 6 90373709 critical splice acceptor site probably null
IGL02623:Zxdc APN 6 90382370 missense probably damaging 0.99
IGL02927:Zxdc APN 6 90372562 missense probably damaging 1.00
IGL03230:Zxdc APN 6 90373803 missense probably damaging 1.00
PIT4378001:Zxdc UTSW 6 90373716 missense probably damaging 1.00
R0071:Zxdc UTSW 6 90370416 missense probably damaging 1.00
R0194:Zxdc UTSW 6 90372537 intron probably benign
R1065:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1377:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1692:Zxdc UTSW 6 90378951 nonsense probably null
R2171:Zxdc UTSW 6 90382479 missense possibly damaging 0.53
R3952:Zxdc UTSW 6 90370467 intron probably null
R4400:Zxdc UTSW 6 90369810 missense probably damaging 1.00
R4660:Zxdc UTSW 6 90378838 missense probably damaging 0.99
R4776:Zxdc UTSW 6 90370518 missense probably damaging 1.00
R4781:Zxdc UTSW 6 90372553 missense probably damaging 0.98
R5028:Zxdc UTSW 6 90382338 missense probably benign 0.44
R5260:Zxdc UTSW 6 90382093 missense probably damaging 1.00
R5279:Zxdc UTSW 6 90370437 missense possibly damaging 0.86
R5324:Zxdc UTSW 6 90373800 missense probably damaging 1.00
R5363:Zxdc UTSW 6 90382146 missense probably damaging 0.97
R5436:Zxdc UTSW 6 90370560 missense probably damaging 0.99
R5872:Zxdc UTSW 6 90370299 missense probably damaging 0.99
R5940:Zxdc UTSW 6 90370325 missense probably damaging 1.00
R6762:Zxdc UTSW 6 90382183 missense probably benign
R7175:Zxdc UTSW 6 90369663 missense possibly damaging 0.85
R7197:Zxdc UTSW 6 90378837 missense probably damaging 0.99
R7238:Zxdc UTSW 6 90369660 missense unknown
R7247:Zxdc UTSW 6 90384173 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGTGGCCCACGGTGATATG -3'
(R):5'- CTGAGCTCTGAGTCCTTCTG -3'

Sequencing Primer
(F):5'- CACGGTGATATGCCTCCAAGTTTG -3'
(R):5'- CCTCTCTGTAGAGCTGGACAG -3'
Posted On2016-03-01