Incidental Mutation 'R4843:Olfr494'
ID371990
Institutional Source Beutler Lab
Gene Symbol Olfr494
Ensembl Gene ENSMUSG00000109631
Gene Nameolfactory receptor 494
SynonymsMOR204-10, GA_x6K02T2PBJ9-10697517-10698461
MMRRC Submission 042456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4843 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108365335-108368436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108368143 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 218 (A218T)
Ref Sequence ENSEMBL: ENSMUSP00000147830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000209743] [ENSMUST00000210291]
Predicted Effect probably benign
Transcript: ENSMUST00000073059
AA Change: A218T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: A218T

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209743
AA Change: A218T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000210291
AA Change: A218T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.4665 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp1 T A 12: 30,896,145 K124* probably null Het
Actl11 G T 9: 107,929,492 C338F possibly damaging Het
Adam5 G A 8: 24,813,536 S125F probably damaging Het
Ap2s1 C A 7: 16,743,346 A44D possibly damaging Het
AW554918 T C 18: 25,340,000 V84A probably benign Het
Bsn G A 9: 108,107,189 T3222M unknown Het
Car15 A G 16: 17,836,608 Y155H possibly damaging Het
Cdca2 G T 14: 67,676,976 P945T probably damaging Het
Cdh16 A G 8: 104,621,540 F182L probably damaging Het
Cers6 G A 2: 69,068,659 A214T probably benign Het
Ces1g A T 8: 93,331,265 M136K probably damaging Het
Cnppd1 A G 1: 75,136,442 V394A probably benign Het
Cyp3a59 A T 5: 146,096,261 I148F possibly damaging Het
Dnah1 G A 14: 31,264,963 A3624V probably damaging Het
Exoc3l4 T C 12: 111,428,053 probably benign Het
Fap G T 2: 62,544,374 P227Q probably damaging Het
Fbxw10 G A 11: 62,847,325 R15H possibly damaging Het
Gm11011 T C 2: 169,587,320 probably benign Het
Gm11146 A C 16: 77,595,256 probably benign Het
Grip1 G A 10: 119,930,015 R84Q probably damaging Het
Hipk2 A G 6: 38,819,257 C19R possibly damaging Het
Hmgcll1 A G 9: 76,072,634 D102G possibly damaging Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kank1 T G 19: 25,431,007 S1283R probably damaging Het
Kcnip1 T A 11: 33,644,504 H95L probably benign Het
L3mbtl3 A T 10: 26,331,879 L314Q unknown Het
Marveld3 C A 8: 109,962,070 R13L possibly damaging Het
Mtrf1l G T 10: 5,823,696 P23Q possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr786 G T 10: 129,437,447 V212L probably benign Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Plod3 G A 5: 136,991,000 W428* probably null Het
Pnisr T A 4: 21,857,400 probably benign Het
Ppip5k1 C A 2: 121,326,887 R1046L probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prmt5 A T 14: 54,516,125 I99N probably benign Het
Ripk2 T C 4: 16,155,073 T149A probably damaging Het
Rpf2 C A 10: 40,247,002 probably benign Het
Rtf1 T A 2: 119,705,536 D190E possibly damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Snd1 T G 6: 28,668,643 V443G probably damaging Het
Spag9 T C 11: 94,097,818 F555L probably damaging Het
Srfbp1 A G 18: 52,488,677 K270R probably benign Het
Tenm2 T A 11: 36,024,020 N2230I probably damaging Het
Tmem106a T C 11: 101,586,195 probably benign Het
Tpsg1 A T 17: 25,370,617 probably benign Het
Trank1 A G 9: 111,366,078 S1057G probably benign Het
Unc13d G A 11: 116,074,259 T220M probably damaging Het
Vmn1r68 T C 7: 10,527,977 T65A probably benign Het
Vps50 T C 6: 3,536,974 probably null Het
Washc5 A G 15: 59,350,371 I85T possibly damaging Het
Zfp677 C T 17: 21,392,526 T2I probably benign Het
Zxdc A G 6: 90,382,272 T629A possibly damaging Het
Other mutations in Olfr494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Olfr494 APN 7 108368318 missense probably damaging 1.00
IGL01934:Olfr494 APN 7 108368161 missense probably damaging 0.99
IGL02041:Olfr494 APN 7 108367535 missense probably damaging 1.00
IGL02253:Olfr494 APN 7 108368054 missense possibly damaging 0.80
IGL02902:Olfr494 APN 7 108368129 missense probably damaging 1.00
R0125:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R0523:Olfr494 UTSW 7 108368231 missense probably damaging 1.00
R0650:Olfr494 UTSW 7 108367789 missense probably damaging 1.00
R1268:Olfr494 UTSW 7 108367795 missense probably benign 0.06
R2036:Olfr494 UTSW 7 108367740 missense probably benign 0.00
R2162:Olfr494 UTSW 7 108367562 missense probably benign 0.08
R2278:Olfr494 UTSW 7 108368081 missense probably benign 0.01
R2368:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R3410:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3411:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3834:Olfr494 UTSW 7 108368072 missense probably damaging 0.98
R4322:Olfr494 UTSW 7 108368348 missense probably damaging 1.00
R4625:Olfr494 UTSW 7 108367688 missense probably damaging 0.98
R4724:Olfr494 UTSW 7 108367998 missense probably benign
R5525:Olfr494 UTSW 7 108367999 missense probably benign
R5954:Olfr494 UTSW 7 108367601 missense probably damaging 0.98
R7027:Olfr494 UTSW 7 108368350 missense probably damaging 0.98
R8041:Olfr494 UTSW 7 108367534 missense probably damaging 1.00
R8237:Olfr494 UTSW 7 108368027 missense probably damaging 1.00
Z1177:Olfr494 UTSW 7 108368261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCCAGTTAGTCGTGGGATC -3'
(R):5'- ACCACCTTATTCTGGTCTGTGG -3'

Sequencing Primer
(F):5'- CCAGTTAGTCGTGGGATCTTATATAG -3'
(R):5'- CCACCTTATTCTGGTCTGTGGAGTAG -3'
Posted On2016-03-01