Incidental Mutation 'R4843:Adam5'
ID371992
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
MMRRC Submission 042456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4843 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24813536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 125 (S125F)
Ref Sequence ENSEMBL: ENSMUSP00000147290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect probably damaging
Transcript: ENSMUST00000050300
AA Change: S125F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: S125F

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118419
AA Change: S125F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: S125F

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130939
Predicted Effect unknown
Transcript: ENSMUST00000132180
AA Change: S42F
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: S42F

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209935
AA Change: S125F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp1 T A 12: 30,896,145 K124* probably null Het
Actl11 G T 9: 107,929,492 C338F possibly damaging Het
Ap2s1 C A 7: 16,743,346 A44D possibly damaging Het
AW554918 T C 18: 25,340,000 V84A probably benign Het
Bsn G A 9: 108,107,189 T3222M unknown Het
Car15 A G 16: 17,836,608 Y155H possibly damaging Het
Cdca2 G T 14: 67,676,976 P945T probably damaging Het
Cdh16 A G 8: 104,621,540 F182L probably damaging Het
Cers6 G A 2: 69,068,659 A214T probably benign Het
Ces1g A T 8: 93,331,265 M136K probably damaging Het
Cnppd1 A G 1: 75,136,442 V394A probably benign Het
Cyp3a59 A T 5: 146,096,261 I148F possibly damaging Het
Dnah1 G A 14: 31,264,963 A3624V probably damaging Het
Exoc3l4 T C 12: 111,428,053 probably benign Het
Fap G T 2: 62,544,374 P227Q probably damaging Het
Fbxw10 G A 11: 62,847,325 R15H possibly damaging Het
Gm11011 T C 2: 169,587,320 probably benign Het
Gm11146 A C 16: 77,595,256 probably benign Het
Grip1 G A 10: 119,930,015 R84Q probably damaging Het
Hipk2 A G 6: 38,819,257 C19R possibly damaging Het
Hmgcll1 A G 9: 76,072,634 D102G possibly damaging Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kank1 T G 19: 25,431,007 S1283R probably damaging Het
Kcnip1 T A 11: 33,644,504 H95L probably benign Het
L3mbtl3 A T 10: 26,331,879 L314Q unknown Het
Marveld3 C A 8: 109,962,070 R13L possibly damaging Het
Mtrf1l G T 10: 5,823,696 P23Q possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr494 G A 7: 108,368,143 A218T probably benign Het
Olfr786 G T 10: 129,437,447 V212L probably benign Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Plod3 G A 5: 136,991,000 W428* probably null Het
Pnisr T A 4: 21,857,400 probably benign Het
Ppip5k1 C A 2: 121,326,887 R1046L probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prmt5 A T 14: 54,516,125 I99N probably benign Het
Ripk2 T C 4: 16,155,073 T149A probably damaging Het
Rpf2 C A 10: 40,247,002 probably benign Het
Rtf1 T A 2: 119,705,536 D190E possibly damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Snd1 T G 6: 28,668,643 V443G probably damaging Het
Spag9 T C 11: 94,097,818 F555L probably damaging Het
Srfbp1 A G 18: 52,488,677 K270R probably benign Het
Tenm2 T A 11: 36,024,020 N2230I probably damaging Het
Tmem106a T C 11: 101,586,195 probably benign Het
Tpsg1 A T 17: 25,370,617 probably benign Het
Trank1 A G 9: 111,366,078 S1057G probably benign Het
Unc13d G A 11: 116,074,259 T220M probably damaging Het
Vmn1r68 T C 7: 10,527,977 T65A probably benign Het
Vps50 T C 6: 3,536,974 probably null Het
Washc5 A G 15: 59,350,371 I85T possibly damaging Het
Zfp677 C T 17: 21,392,526 T2I probably benign Het
Zxdc A G 6: 90,382,272 T629A possibly damaging Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5293:Adam5 UTSW 8 24810706 missense possibly damaging 0.46
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
R7469:Adam5 UTSW 8 24815525 missense probably benign 0.45
R7780:Adam5 UTSW 8 24804416 missense possibly damaging 0.49
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTGAGCACTGACCTTC -3'
(R):5'- TGGTGACACACATCCACATC -3'

Sequencing Primer
(F):5'- GAGTGAGCACTGACCTTCATGTTAC -3'
(R):5'- CCCATAGCACAGTGATGTAGTTCTG -3'
Posted On2016-03-01