Incidental Mutation 'R4843:Marveld3'
ID371995
Institutional Source Beutler Lab
Gene Symbol Marveld3
Ensembl Gene ENSMUSG00000001672
Gene NameMARVEL (membrane-associating) domain containing 3
Synonyms1810006A16Rik, MARVD3, Mrvldc3
MMRRC Submission 042456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4843 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109947914-109962203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109962070 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 13 (R13L)
Ref Sequence ENSEMBL: ENSMUSP00000001722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001722] [ENSMUST00000051430]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001722
AA Change: R13L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001722
Gene: ENSMUSG00000001672
AA Change: R13L

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000051430
AA Change: R13L
SMART Domains Protein: ENSMUSP00000052309
Gene: ENSMUSG00000001672
AA Change: R13L

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
Pfam:MARVEL 168 355 3.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155052
Meta Mutation Damage Score 0.1202 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp1 T A 12: 30,896,145 K124* probably null Het
Actl11 G T 9: 107,929,492 C338F possibly damaging Het
Adam5 G A 8: 24,813,536 S125F probably damaging Het
Ap2s1 C A 7: 16,743,346 A44D possibly damaging Het
AW554918 T C 18: 25,340,000 V84A probably benign Het
Bsn G A 9: 108,107,189 T3222M unknown Het
Car15 A G 16: 17,836,608 Y155H possibly damaging Het
Cdca2 G T 14: 67,676,976 P945T probably damaging Het
Cdh16 A G 8: 104,621,540 F182L probably damaging Het
Cers6 G A 2: 69,068,659 A214T probably benign Het
Ces1g A T 8: 93,331,265 M136K probably damaging Het
Cnppd1 A G 1: 75,136,442 V394A probably benign Het
Cyp3a59 A T 5: 146,096,261 I148F possibly damaging Het
Dnah1 G A 14: 31,264,963 A3624V probably damaging Het
Exoc3l4 T C 12: 111,428,053 probably benign Het
Fap G T 2: 62,544,374 P227Q probably damaging Het
Fbxw10 G A 11: 62,847,325 R15H possibly damaging Het
Gm11011 T C 2: 169,587,320 probably benign Het
Gm11146 A C 16: 77,595,256 probably benign Het
Grip1 G A 10: 119,930,015 R84Q probably damaging Het
Hipk2 A G 6: 38,819,257 C19R possibly damaging Het
Hmgcll1 A G 9: 76,072,634 D102G possibly damaging Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kank1 T G 19: 25,431,007 S1283R probably damaging Het
Kcnip1 T A 11: 33,644,504 H95L probably benign Het
L3mbtl3 A T 10: 26,331,879 L314Q unknown Het
Mtrf1l G T 10: 5,823,696 P23Q possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr494 G A 7: 108,368,143 A218T probably benign Het
Olfr786 G T 10: 129,437,447 V212L probably benign Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Plod3 G A 5: 136,991,000 W428* probably null Het
Pnisr T A 4: 21,857,400 probably benign Het
Ppip5k1 C A 2: 121,326,887 R1046L probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Prmt5 A T 14: 54,516,125 I99N probably benign Het
Ripk2 T C 4: 16,155,073 T149A probably damaging Het
Rpf2 C A 10: 40,247,002 probably benign Het
Rtf1 T A 2: 119,705,536 D190E possibly damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Snd1 T G 6: 28,668,643 V443G probably damaging Het
Spag9 T C 11: 94,097,818 F555L probably damaging Het
Srfbp1 A G 18: 52,488,677 K270R probably benign Het
Tenm2 T A 11: 36,024,020 N2230I probably damaging Het
Tmem106a T C 11: 101,586,195 probably benign Het
Tpsg1 A T 17: 25,370,617 probably benign Het
Trank1 A G 9: 111,366,078 S1057G probably benign Het
Unc13d G A 11: 116,074,259 T220M probably damaging Het
Vmn1r68 T C 7: 10,527,977 T65A probably benign Het
Vps50 T C 6: 3,536,974 probably null Het
Washc5 A G 15: 59,350,371 I85T possibly damaging Het
Zfp677 C T 17: 21,392,526 T2I probably benign Het
Zxdc A G 6: 90,382,272 T629A possibly damaging Het
Other mutations in Marveld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Marveld3 APN 8 109961964 missense possibly damaging 0.81
IGL01341:Marveld3 APN 8 109948417 missense possibly damaging 0.94
IGL01415:Marveld3 APN 8 109962073 missense possibly damaging 0.92
IGL01759:Marveld3 APN 8 109948087 missense possibly damaging 0.90
IGL02012:Marveld3 APN 8 109948132 missense probably damaging 0.99
R0732:Marveld3 UTSW 8 109948483 missense probably damaging 0.99
R1500:Marveld3 UTSW 8 109948542 unclassified probably null
R1955:Marveld3 UTSW 8 109959748 missense probably benign 0.08
R2146:Marveld3 UTSW 8 109959802 missense probably benign 0.00
R2172:Marveld3 UTSW 8 109961846 missense probably benign 0.22
R4925:Marveld3 UTSW 8 109948311 missense probably benign 0.00
R5542:Marveld3 UTSW 8 109948617 missense probably benign 0.03
R6003:Marveld3 UTSW 8 109954328 missense probably damaging 1.00
R6733:Marveld3 UTSW 8 109962049 missense possibly damaging 0.90
R6786:Marveld3 UTSW 8 109948100 missense probably benign 0.13
R7156:Marveld3 UTSW 8 109948188 missense probably damaging 1.00
R7194:Marveld3 UTSW 8 109959845 splice site probably null
R7429:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7430:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7810:Marveld3 UTSW 8 109954634 missense probably damaging 0.99
Z1088:Marveld3 UTSW 8 109948063 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTCCAAGGCTCTTTGTTCGG -3'
(R):5'- GGACTGACATCTATTTCAGCAAG -3'

Sequencing Primer
(F):5'- CAAGGCTCTTTGTTCGGATGCG -3'
(R):5'- CTGACATCTATTTCAGCAAGAATCC -3'
Posted On2016-03-01