Incidental Mutation 'R4843:Prmt5'
ID372015
Institutional Source Beutler Lab
Gene Symbol Prmt5
Ensembl Gene ENSMUSG00000023110
Gene Nameprotein arginine N-methyltransferase 5
SynonymsJak-binding protein 1, Jbp1, Skb1
MMRRC Submission 042456-MU
Accession Numbers

Genbank: NM_013768.3; Ensembl: ENSMUST00000023873

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4843 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54507187-54517525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54516125 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 99 (I99N)
Ref Sequence ENSEMBL: ENSMUSP00000023873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023873] [ENSMUST00000132227] [ENSMUST00000147214]
Predicted Effect probably benign
Transcript: ENSMUST00000023873
AA Change: I99N

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023873
Gene: ENSMUSG00000023110
AA Change: I99N

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
Pfam:PRMT5 181 619 4.5e-184 PFAM
Pfam:SAMBD 184 465 3e-119 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132227
AA Change: D59E
SMART Domains Protein: ENSMUSP00000138549
Gene: ENSMUSG00000023110
AA Change: D59E

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
PDB:4GQB|A 19 40 5e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138367
Predicted Effect probably benign
Transcript: ENSMUST00000139964
SMART Domains Protein: ENSMUSP00000121502
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
Pfam:PRMT5 1 62 1.3e-10 PFAM
Pfam:SAMBD 1 203 4.6e-68 PFAM
Pfam:PRMT5 52 203 1.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147214
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the methyltransferase family. The encoded protein catalyzes the transfer of methyl groups to the amino acid arginine, in target proteins that include histones, transcriptional elongation factors and the tumor suppressor p53. This gene plays a role in several cellular processes, including transcriptional regulation and the assembly of small nuclear ribonucleoproteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation with failure of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(4) Gene trapped(5)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp1 T A 12: 30,896,145 K124* probably null Het
Actl11 G T 9: 107,929,492 C338F possibly damaging Het
Adam5 G A 8: 24,813,536 S125F probably damaging Het
Ap2s1 C A 7: 16,743,346 A44D possibly damaging Het
AW554918 T C 18: 25,340,000 V84A probably benign Het
Bsn G A 9: 108,107,189 T3222M unknown Het
Car15 A G 16: 17,836,608 Y155H possibly damaging Het
Cdca2 G T 14: 67,676,976 P945T probably damaging Het
Cdh16 A G 8: 104,621,540 F182L probably damaging Het
Cers6 G A 2: 69,068,659 A214T probably benign Het
Ces1g A T 8: 93,331,265 M136K probably damaging Het
Cnppd1 A G 1: 75,136,442 V394A probably benign Het
Cyp3a59 A T 5: 146,096,261 I148F possibly damaging Het
Dnah1 G A 14: 31,264,963 A3624V probably damaging Het
Exoc3l4 T C 12: 111,428,053 probably benign Het
Fap G T 2: 62,544,374 P227Q probably damaging Het
Fbxw10 G A 11: 62,847,325 R15H possibly damaging Het
Gm11011 T C 2: 169,587,320 probably benign Het
Gm11146 A C 16: 77,595,256 probably benign Het
Grip1 G A 10: 119,930,015 R84Q probably damaging Het
Hipk2 A G 6: 38,819,257 C19R possibly damaging Het
Hmgcll1 A G 9: 76,072,634 D102G possibly damaging Het
Ighv16-1 A T 12: 114,068,884 Y99* probably null Het
Kank1 T G 19: 25,431,007 S1283R probably damaging Het
Kcnip1 T A 11: 33,644,504 H95L probably benign Het
L3mbtl3 A T 10: 26,331,879 L314Q unknown Het
Marveld3 C A 8: 109,962,070 R13L possibly damaging Het
Mtrf1l G T 10: 5,823,696 P23Q possibly damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr494 G A 7: 108,368,143 A218T probably benign Het
Olfr786 G T 10: 129,437,447 V212L probably benign Het
Paqr7 A G 4: 134,506,967 Y45C probably damaging Het
Plod3 G A 5: 136,991,000 W428* probably null Het
Pnisr T A 4: 21,857,400 probably benign Het
Ppip5k1 C A 2: 121,326,887 R1046L probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ripk2 T C 4: 16,155,073 T149A probably damaging Het
Rpf2 C A 10: 40,247,002 probably benign Het
Rtf1 T A 2: 119,705,536 D190E possibly damaging Het
Shank2 T A 7: 144,031,409 M49K probably benign Het
Snd1 T G 6: 28,668,643 V443G probably damaging Het
Spag9 T C 11: 94,097,818 F555L probably damaging Het
Srfbp1 A G 18: 52,488,677 K270R probably benign Het
Tenm2 T A 11: 36,024,020 N2230I probably damaging Het
Tmem106a T C 11: 101,586,195 probably benign Het
Tpsg1 A T 17: 25,370,617 probably benign Het
Trank1 A G 9: 111,366,078 S1057G probably benign Het
Unc13d G A 11: 116,074,259 T220M probably damaging Het
Vmn1r68 T C 7: 10,527,977 T65A probably benign Het
Vps50 T C 6: 3,536,974 probably null Het
Washc5 A G 15: 59,350,371 I85T possibly damaging Het
Zfp677 C T 17: 21,392,526 T2I probably benign Het
Zxdc A G 6: 90,382,272 T629A possibly damaging Het
Other mutations in Prmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prmt5 APN 14 54509877 missense probably damaging 1.00
IGL01586:Prmt5 APN 14 54509951 unclassified probably benign
IGL02063:Prmt5 APN 14 54511020 nonsense probably null
IGL02249:Prmt5 APN 14 54509865 missense probably damaging 1.00
IGL03024:Prmt5 APN 14 54516598 missense possibly damaging 0.93
skipper UTSW 14 54509911 missense probably damaging 1.00
1mM(1):Prmt5 UTSW 14 54511500 critical splice donor site probably null
R0485:Prmt5 UTSW 14 54511255 missense probably damaging 1.00
R0664:Prmt5 UTSW 14 54507856 missense probably damaging 0.99
R1473:Prmt5 UTSW 14 54508915 missense probably damaging 1.00
R2106:Prmt5 UTSW 14 54507917 missense probably benign 0.00
R2159:Prmt5 UTSW 14 54515338 missense probably benign 0.03
R4728:Prmt5 UTSW 14 54507907 missense probably benign 0.00
R5261:Prmt5 UTSW 14 54507916 missense probably damaging 0.96
R5277:Prmt5 UTSW 14 54509942 missense probably benign 0.02
R5736:Prmt5 UTSW 14 54514840 missense probably null 0.84
R5892:Prmt5 UTSW 14 54509911 missense probably damaging 1.00
R5945:Prmt5 UTSW 14 54514887 missense possibly damaging 0.52
R7021:Prmt5 UTSW 14 54515388 missense probably damaging 1.00
R7091:Prmt5 UTSW 14 54511342 splice site probably null
R7172:Prmt5 UTSW 14 54514886 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTGACCTAGTTTAGTGACAGAAC -3'
(R):5'- TCAGGCTATCCCTATATCAGAGAC -3'

Sequencing Primer
(F):5'- GAGATTGCAGATAGGTGC -3'
(R):5'- GCTATCCCTATATCAGAGACAAAAAG -3'
Posted On2016-03-01