Mutagenetix > Incidental Mutation

Incidental Mutation 'R4844:Vash2'

372029

Institutional Source

Beutler Lab

Gene Symbol

Vash2

Ensembl Gene

ENSMUSG00000037568

Gene Name

vasohibin 2

Synonyms

B130052G07Rik

MMRRC Submission

042457-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R4844 (G1)

Quality Score

107

Status

Validated

Chromosome

Chromosomal Location

190947646-190979296 bp(-) (GRCm38)

Type of Mutation

utr 5 prime

DNA Base Change (assembly)

C to T at 190978494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000127626 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047409] [ENSMUST00000166139]

AlphaFold

Q8C5G2

Predicted Effect

probably benign
Transcript: ENSMUST00000047409

SMART Domains

Protein: ENSMUSP00000036768
Gene: ENSMUSG00000037568

Domain	Start	End	E-Value	Type
Pfam:Vasohibin	45	291	7e-124	PFAM
low complexity region	312	329	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166139

SMART Domains

Protein: ENSMUSP00000127626
Gene: ENSMUSG00000037568

Domain	Start	End	E-Value	Type
low complexity region	35	46	N/A	INTRINSIC
Pfam:Vasohibin	47	291	1.1e-124	PFAM
low complexity region	312	329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192306

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

97% (68/70)

MGI Phenotype

PHENOTYPE: Homozygous null mice have defects in initiating angiogenesis in response to skin wounding. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	A	G	4: 35,213,565	V31A	possibly damaging	Het
Abcc9	T	C	6: 142,689,098	T147A	probably benign	Het
Acvrl1	T	C	15: 101,135,528	S99P	probably damaging	Het
Adamts3	T	A	5: 89,677,816	S1055C	probably damaging	Het
Aftph	T	C	11: 20,708,667		probably benign	Het
Aldh1a1	A	G	19: 20,634,400	K363E	probably benign	Het
Astn2	A	G	4: 65,644,730	V886A	possibly damaging	Het
Atad5	G	A	11: 80,114,311		probably null	Het
Ccnf	G	T	17: 24,230,357	Y482*	probably null	Het
Cfap97	A	G	8: 46,169,675	D34G	possibly damaging	Het
Chst11	G	T	10: 83,191,089	E117*	probably null	Het
Cobl	A	T	11: 12,254,740	L572Q	probably benign	Het
Coch	G	A	12: 51,602,694	G263S	probably damaging	Het
Coq4	T	C	2: 29,796,014	I205T	possibly damaging	Het
Cyp3a13	A	T	5: 137,917,551	I62K	probably benign	Het
Cyp7a1	A	G	4: 6,273,655	S84P	probably damaging	Het
Fam45a	GTCT	GT	19: 60,834,997		probably null	Het
G6pc3	G	A	11: 102,193,231		probably null	Het
Gm10576	T	C	4: 101,054,510		noncoding transcript	Het
Gm17511	G	A	7: 127,286,282		noncoding transcript	Het
Gnat2	T	C	3: 108,095,515	S80P	probably damaging	Het
Gpaa1	C	T	15: 76,332,308		probably benign	Het
Gpr107	T	A	2: 31,188,674		probably null	Het
Hormad1	T	C	3: 95,570,931	Y103H	probably damaging	Het
Ighv14-1	T	G	12: 113,932,002	Q101P	probably damaging	Het
Igsf9	A	G	1: 172,497,170	D885G	probably benign	Het
Il15ra	G	A	2: 11,718,271		probably benign	Het
Islr2	C	T	9: 58,208,234		probably benign	Het
Jak3	A	T	8: 71,681,655	N467I	possibly damaging	Het
Jarid2	T	C	13: 44,913,772	V1023A	probably damaging	Het
Kcnn2	A	T	18: 45,683,120	T333S	possibly damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Kmt2c	T	C	5: 25,315,113	T2000A	probably benign	Het
Lpxn	A	G	19: 12,833,172	T327A	probably damaging	Het
Mxra8	A	G	4: 155,842,694	T362A	probably benign	Het
Myh6	A	G	14: 54,947,194	I1560T	possibly damaging	Het
Ndufv1	A	G	19: 4,012,574	S17P	probably benign	Het
Nwd1	A	T	8: 72,667,114	H335L	probably damaging	Het
Olfr38	T	A	6: 42,762,460	M136K	probably damaging	Het
Olfr403	A	G	11: 74,196,076	D191G	probably damaging	Het
Otop2	G	A	11: 115,323,375		probably null	Het
Pwwp2b	C	A	7: 139,255,586	S314R	probably benign	Het
Rfx7	C	T	9: 72,593,242	Q95*	probably null	Het
Serpine2	A	T	1: 79,799,524	L192*	probably null	Het
Smpdl3b	T	C	4: 132,738,058	I322M	probably damaging	Het
Spata31d1b	C	T	13: 59,718,355	R1106C	possibly damaging	Het
Sprr2k	T	G	3: 92,429,425		probably null	Het
St8sia1	T	A	6: 142,829,270	R194S	possibly damaging	Het
Sv2a	T	A	3: 96,188,379	V337D	probably damaging	Het
Tars	G	A	15: 11,385,195	R637W	possibly damaging	Het
Tcp11l2	G	T	10: 84,613,691	V507L	probably benign	Het
Tpr	T	C	1: 150,445,879	Y2262H	possibly damaging	Het
Vars	A	G	17: 35,011,612	E529G	probably damaging	Het
Vmn1r194	T	C	13: 22,245,053	V280A	probably benign	Het
Vti1a	A	G	19: 55,391,865	T142A	probably damaging	Het
Zfp111	C	T	7: 24,199,376	C270Y	probably damaging	Het
Zfp518a	T	A	19: 40,914,896	Y1090N	probably damaging	Het
Zfp616	A	T	11: 74,084,399	Y498F	probably benign	Het

Other mutations in Vash2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02345:Vash2	APN	1	190978215	missense	probably benign	0.15
Logical	UTSW	1	190960225	missense	probably benign	0.11
R0507:Vash2	UTSW	1	190966918	splice site	probably benign
R2265:Vash2	UTSW	1	190950213	missense	probably damaging	0.97
R3615:Vash2	UTSW	1	190970419	missense	probably damaging	1.00
R3616:Vash2	UTSW	1	190970419	missense	probably damaging	1.00
R4610:Vash2	UTSW	1	190960301	missense	probably benign	0.04
R5569:Vash2	UTSW	1	190960291	missense	possibly damaging	0.65
R6282:Vash2	UTSW	1	190960225	missense	probably benign	0.11
R6312:Vash2	UTSW	1	190958683	missense	probably benign	0.29
R6468:Vash2	UTSW	1	190978287	missense	probably damaging	1.00
R7362:Vash2	UTSW	1	190960299	missense	probably damaging	1.00
X0021:Vash2	UTSW	1	190960444	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCCGCTCTTGTTCACGTG -3'
(R):5'- GAAGCTCGCGTTAGTCCTGAAG -3'

Sequencing Primer
(F):5'- TTCACGTGGAACAGCACC -3'
(R):5'- AGTCCTGAAGGGTGGGTC -3'

Posted On

2016-03-01