Incidental Mutation 'R4844:Mxra8'
ID372041
Institutional Source Beutler Lab
Gene Symbol Mxra8
Ensembl Gene ENSMUSG00000029070
Gene Namematrix-remodelling associated 8
Synonyms
MMRRC Submission 042457-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4844 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155839680-155844088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155842694 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 362 (T362A)
Ref Sequence ENSEMBL: ENSMUSP00000030947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030947] [ENSMUST00000030948] [ENSMUST00000141883] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030947
AA Change: T362A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030947
Gene: ENSMUSG00000029070
AA Change: T362A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 38 156 6.16e-4 SMART
IG 170 291 9.71e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
low complexity region 371 384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141766
Predicted Effect probably benign
Transcript: ENSMUST00000141883
SMART Domains Protein: ENSMUSP00000114929
Gene: ENSMUSG00000029070

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 35 153 6.16e-4 SMART
IG 167 288 9.71e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (68/70)
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,213,565 V31A possibly damaging Het
Abcc9 T C 6: 142,689,098 T147A probably benign Het
Acvrl1 T C 15: 101,135,528 S99P probably damaging Het
Adamts3 T A 5: 89,677,816 S1055C probably damaging Het
Aftph T C 11: 20,708,667 probably benign Het
Aldh1a1 A G 19: 20,634,400 K363E probably benign Het
Astn2 A G 4: 65,644,730 V886A possibly damaging Het
Atad5 G A 11: 80,114,311 probably null Het
Ccnf G T 17: 24,230,357 Y482* probably null Het
Cfap97 A G 8: 46,169,675 D34G possibly damaging Het
Chst11 G T 10: 83,191,089 E117* probably null Het
Cobl A T 11: 12,254,740 L572Q probably benign Het
Coch G A 12: 51,602,694 G263S probably damaging Het
Coq4 T C 2: 29,796,014 I205T possibly damaging Het
Cyp3a13 A T 5: 137,917,551 I62K probably benign Het
Cyp7a1 A G 4: 6,273,655 S84P probably damaging Het
Fam45a GTCT GT 19: 60,834,997 probably null Het
G6pc3 G A 11: 102,193,231 probably null Het
Gm10576 T C 4: 101,054,510 noncoding transcript Het
Gm17511 G A 7: 127,286,282 noncoding transcript Het
Gnat2 T C 3: 108,095,515 S80P probably damaging Het
Gpaa1 C T 15: 76,332,308 probably benign Het
Gpr107 T A 2: 31,188,674 probably null Het
Hormad1 T C 3: 95,570,931 Y103H probably damaging Het
Ighv14-1 T G 12: 113,932,002 Q101P probably damaging Het
Igsf9 A G 1: 172,497,170 D885G probably benign Het
Il15ra G A 2: 11,718,271 probably benign Het
Islr2 C T 9: 58,208,234 probably benign Het
Jak3 A T 8: 71,681,655 N467I possibly damaging Het
Jarid2 T C 13: 44,913,772 V1023A probably damaging Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2c T C 5: 25,315,113 T2000A probably benign Het
Lpxn A G 19: 12,833,172 T327A probably damaging Het
Myh6 A G 14: 54,947,194 I1560T possibly damaging Het
Ndufv1 A G 19: 4,012,574 S17P probably benign Het
Nwd1 A T 8: 72,667,114 H335L probably damaging Het
Olfr38 T A 6: 42,762,460 M136K probably damaging Het
Olfr403 A G 11: 74,196,076 D191G probably damaging Het
Otop2 G A 11: 115,323,375 probably null Het
Pwwp2b C A 7: 139,255,586 S314R probably benign Het
Rfx7 C T 9: 72,593,242 Q95* probably null Het
Serpine2 A T 1: 79,799,524 L192* probably null Het
Smpdl3b T C 4: 132,738,058 I322M probably damaging Het
Spata31d1b C T 13: 59,718,355 R1106C possibly damaging Het
Sprr2k T G 3: 92,429,425 probably null Het
St8sia1 T A 6: 142,829,270 R194S possibly damaging Het
Sv2a T A 3: 96,188,379 V337D probably damaging Het
Tars G A 15: 11,385,195 R637W possibly damaging Het
Tcp11l2 G T 10: 84,613,691 V507L probably benign Het
Tpr T C 1: 150,445,879 Y2262H possibly damaging Het
Vars A G 17: 35,011,612 E529G probably damaging Het
Vash2 C T 1: 190,978,494 probably benign Het
Vmn1r194 T C 13: 22,245,053 V280A probably benign Het
Vti1a A G 19: 55,391,865 T142A probably damaging Het
Zfp111 C T 7: 24,199,376 C270Y probably damaging Het
Zfp518a T A 19: 40,914,896 Y1090N probably damaging Het
Zfp616 A T 11: 74,084,399 Y498F probably benign Het
Other mutations in Mxra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mxra8 APN 4 155842563 missense probably benign 0.06
IGL01871:Mxra8 APN 4 155842801 missense probably benign
IGL02900:Mxra8 APN 4 155841119 missense possibly damaging 0.52
IGL02900:Mxra8 APN 4 155841211 splice site probably null
Buffet UTSW 4 155843136 missense possibly damaging 0.89
R0206:Mxra8 UTSW 4 155842596 missense probably damaging 0.97
R0206:Mxra8 UTSW 4 155842596 missense probably damaging 0.97
R0513:Mxra8 UTSW 4 155841733 missense probably benign 0.00
R1318:Mxra8 UTSW 4 155841499 missense probably damaging 1.00
R1414:Mxra8 UTSW 4 155841007 missense probably damaging 0.99
R1775:Mxra8 UTSW 4 155843074 missense probably damaging 1.00
R2473:Mxra8 UTSW 4 155842043 missense probably damaging 0.99
R4270:Mxra8 UTSW 4 155841137 missense probably damaging 0.96
R4519:Mxra8 UTSW 4 155842983 critical splice donor site probably null
R4849:Mxra8 UTSW 4 155840874 intron probably benign
R4912:Mxra8 UTSW 4 155840904 splice site probably null
R4929:Mxra8 UTSW 4 155842661 missense probably damaging 1.00
R5567:Mxra8 UTSW 4 155841008 missense probably damaging 1.00
R5665:Mxra8 UTSW 4 155842921 missense probably benign 0.01
R5913:Mxra8 UTSW 4 155843303 critical splice acceptor site probably null
R6250:Mxra8 UTSW 4 155841089 missense possibly damaging 0.95
R6857:Mxra8 UTSW 4 155843136 missense possibly damaging 0.89
R7142:Mxra8 UTSW 4 155843062 missense probably benign 0.23
R7658:Mxra8 UTSW 4 155842963 missense probably benign 0.04
R7842:Mxra8 UTSW 4 155842910 missense probably damaging 1.00
R7925:Mxra8 UTSW 4 155842910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTAGAGGTATTGCCACGG -3'
(R):5'- TAGCAGTTTAGGAGGCCAGG -3'

Sequencing Primer
(F):5'- CTGCCTCCTGAGTGATGAGATTAAAG -3'
(R):5'- CAGGGCAGGACAGGTCTG -3'
Posted On2016-03-01