Incidental Mutation 'R4844:Adamts3'
ID 372043
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms 6330442E02Rik, 1100001H14Rik
MMRRC Submission 042457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4844 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 89677087-89883334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89677816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 1055 (S1055C)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably damaging
Transcript: ENSMUST00000061427
AA Change: S1054C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: S1054C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122551
Predicted Effect probably damaging
Transcript: ENSMUST00000163159
AA Change: S1055C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: S1055C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Meta Mutation Damage Score 0.1402 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,213,565 V31A possibly damaging Het
Abcc9 T C 6: 142,689,098 T147A probably benign Het
Acvrl1 T C 15: 101,135,528 S99P probably damaging Het
Aftph T C 11: 20,708,667 probably benign Het
Aldh1a1 A G 19: 20,634,400 K363E probably benign Het
Astn2 A G 4: 65,644,730 V886A possibly damaging Het
Atad5 G A 11: 80,114,311 probably null Het
Ccnf G T 17: 24,230,357 Y482* probably null Het
Cfap97 A G 8: 46,169,675 D34G possibly damaging Het
Chst11 G T 10: 83,191,089 E117* probably null Het
Cobl A T 11: 12,254,740 L572Q probably benign Het
Coch G A 12: 51,602,694 G263S probably damaging Het
Coq4 T C 2: 29,796,014 I205T possibly damaging Het
Cyp3a13 A T 5: 137,917,551 I62K probably benign Het
Cyp7a1 A G 4: 6,273,655 S84P probably damaging Het
Fam45a GTCT GT 19: 60,834,997 probably null Het
G6pc3 G A 11: 102,193,231 probably null Het
Gm10576 T C 4: 101,054,510 noncoding transcript Het
Gm17511 G A 7: 127,286,282 noncoding transcript Het
Gnat2 T C 3: 108,095,515 S80P probably damaging Het
Gpaa1 C T 15: 76,332,308 probably benign Het
Gpr107 T A 2: 31,188,674 probably null Het
Hormad1 T C 3: 95,570,931 Y103H probably damaging Het
Ighv14-1 T G 12: 113,932,002 Q101P probably damaging Het
Igsf9 A G 1: 172,497,170 D885G probably benign Het
Il15ra G A 2: 11,718,271 probably benign Het
Islr2 C T 9: 58,208,234 probably benign Het
Jak3 A T 8: 71,681,655 N467I possibly damaging Het
Jarid2 T C 13: 44,913,772 V1023A probably damaging Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2c T C 5: 25,315,113 T2000A probably benign Het
Lpxn A G 19: 12,833,172 T327A probably damaging Het
Mxra8 A G 4: 155,842,694 T362A probably benign Het
Myh6 A G 14: 54,947,194 I1560T possibly damaging Het
Ndufv1 A G 19: 4,012,574 S17P probably benign Het
Nwd1 A T 8: 72,667,114 H335L probably damaging Het
Olfr38 T A 6: 42,762,460 M136K probably damaging Het
Olfr403 A G 11: 74,196,076 D191G probably damaging Het
Otop2 G A 11: 115,323,375 probably null Het
Pwwp2b C A 7: 139,255,586 S314R probably benign Het
Rfx7 C T 9: 72,593,242 Q95* probably null Het
Serpine2 A T 1: 79,799,524 L192* probably null Het
Smpdl3b T C 4: 132,738,058 I322M probably damaging Het
Spata31d1b C T 13: 59,718,355 R1106C possibly damaging Het
Sprr2k T G 3: 92,429,425 probably null Het
St8sia1 T A 6: 142,829,270 R194S possibly damaging Het
Sv2a T A 3: 96,188,379 V337D probably damaging Het
Tars G A 15: 11,385,195 R637W possibly damaging Het
Tcp11l2 G T 10: 84,613,691 V507L probably benign Het
Tpr T C 1: 150,445,879 Y2262H possibly damaging Het
Vars A G 17: 35,011,612 E529G probably damaging Het
Vash2 C T 1: 190,978,494 probably benign Het
Vmn1r194 T C 13: 22,245,053 V280A probably benign Het
Vti1a A G 19: 55,391,865 T142A probably damaging Het
Zfp111 C T 7: 24,199,376 C270Y probably damaging Het
Zfp518a T A 19: 40,914,896 Y1090N probably damaging Het
Zfp616 A T 11: 74,084,399 Y498F probably benign Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89775423 missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89702956 missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89694768 missense probably benign 0.19
R8827:Adamts3 UTSW 5 89691465 missense probably benign 0.03
R8864:Adamts3 UTSW 5 89707122 intron probably benign
R8906:Adamts3 UTSW 5 89677716 missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89706711 missense probably benign 0.17
R9005:Adamts3 UTSW 5 89677834 missense probably benign 0.08
R9378:Adamts3 UTSW 5 89700410 nonsense probably null
R9505:Adamts3 UTSW 5 89707892 missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89686891 missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- AGCATCCGCATTGGGGTTTG -3'
(R):5'- GCTATCTCTGACAGTACATCCTG -3'

Sequencing Primer
(F):5'- TTTGCCATGGAAGAGAAGCTACTC -3'
(R):5'- GCAGATGAGCCATGTTTG -3'
Posted On 2016-03-01