Incidental Mutation 'R4844:Olfr38'
ID372046
Institutional Source Beutler Lab
Gene Symbol Olfr38
Ensembl Gene ENSMUSG00000095236
Gene Nameolfactory receptor 38
SynonymsMOR257-2, 18A, GA_x6K02T2P3E9-4797841-4796888
MMRRC Submission 042457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4844 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42756404-42763231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42762460 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 136 (M136K)
Ref Sequence ENSEMBL: ENSMUSP00000149726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074499] [ENSMUST00000215796]
Predicted Effect probably damaging
Transcript: ENSMUST00000074499
AA Change: M136K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093654
Gene: ENSMUSG00000095236
AA Change: M136K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-52 PFAM
Pfam:7tm_1 41 290 5.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215796
AA Change: M136K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.3711 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,213,565 V31A possibly damaging Het
Abcc9 T C 6: 142,689,098 T147A probably benign Het
Acvrl1 T C 15: 101,135,528 S99P probably damaging Het
Adamts3 T A 5: 89,677,816 S1055C probably damaging Het
Aftph T C 11: 20,708,667 probably benign Het
Aldh1a1 A G 19: 20,634,400 K363E probably benign Het
Astn2 A G 4: 65,644,730 V886A possibly damaging Het
Atad5 G A 11: 80,114,311 probably null Het
Ccnf G T 17: 24,230,357 Y482* probably null Het
Cfap97 A G 8: 46,169,675 D34G possibly damaging Het
Chst11 G T 10: 83,191,089 E117* probably null Het
Cobl A T 11: 12,254,740 L572Q probably benign Het
Coch G A 12: 51,602,694 G263S probably damaging Het
Coq4 T C 2: 29,796,014 I205T possibly damaging Het
Cyp3a13 A T 5: 137,917,551 I62K probably benign Het
Cyp7a1 A G 4: 6,273,655 S84P probably damaging Het
Fam45a GTCT GT 19: 60,834,997 probably null Het
G6pc3 G A 11: 102,193,231 probably null Het
Gm10576 T C 4: 101,054,510 noncoding transcript Het
Gm17511 G A 7: 127,286,282 noncoding transcript Het
Gnat2 T C 3: 108,095,515 S80P probably damaging Het
Gpaa1 C T 15: 76,332,308 probably benign Het
Gpr107 T A 2: 31,188,674 probably null Het
Hormad1 T C 3: 95,570,931 Y103H probably damaging Het
Ighv14-1 T G 12: 113,932,002 Q101P probably damaging Het
Igsf9 A G 1: 172,497,170 D885G probably benign Het
Il15ra G A 2: 11,718,271 probably benign Het
Islr2 C T 9: 58,208,234 probably benign Het
Jak3 A T 8: 71,681,655 N467I possibly damaging Het
Jarid2 T C 13: 44,913,772 V1023A probably damaging Het
Kcnn2 A T 18: 45,683,120 T333S possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2c T C 5: 25,315,113 T2000A probably benign Het
Lpxn A G 19: 12,833,172 T327A probably damaging Het
Mxra8 A G 4: 155,842,694 T362A probably benign Het
Myh6 A G 14: 54,947,194 I1560T possibly damaging Het
Ndufv1 A G 19: 4,012,574 S17P probably benign Het
Nwd1 A T 8: 72,667,114 H335L probably damaging Het
Olfr403 A G 11: 74,196,076 D191G probably damaging Het
Otop2 G A 11: 115,323,375 probably null Het
Pwwp2b C A 7: 139,255,586 S314R probably benign Het
Rfx7 C T 9: 72,593,242 Q95* probably null Het
Serpine2 A T 1: 79,799,524 L192* probably null Het
Smpdl3b T C 4: 132,738,058 I322M probably damaging Het
Spata31d1b C T 13: 59,718,355 R1106C possibly damaging Het
Sprr2k T G 3: 92,429,425 probably null Het
St8sia1 T A 6: 142,829,270 R194S possibly damaging Het
Sv2a T A 3: 96,188,379 V337D probably damaging Het
Tars G A 15: 11,385,195 R637W possibly damaging Het
Tcp11l2 G T 10: 84,613,691 V507L probably benign Het
Tpr T C 1: 150,445,879 Y2262H possibly damaging Het
Vars A G 17: 35,011,612 E529G probably damaging Het
Vash2 C T 1: 190,978,494 probably benign Het
Vmn1r194 T C 13: 22,245,053 V280A probably benign Het
Vti1a A G 19: 55,391,865 T142A probably damaging Het
Zfp111 C T 7: 24,199,376 C270Y probably damaging Het
Zfp518a T A 19: 40,914,896 Y1090N probably damaging Het
Zfp616 A T 11: 74,084,399 Y498F probably benign Het
Other mutations in Olfr38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Olfr38 APN 6 42762112 missense probably damaging 0.99
IGL01567:Olfr38 APN 6 42762727 missense probably benign 0.07
IGL02097:Olfr38 APN 6 42762460 missense probably damaging 0.98
IGL02186:Olfr38 APN 6 42762946 missense probably null 0.96
IGL02473:Olfr38 APN 6 42762706 missense probably damaging 1.00
R0541:Olfr38 UTSW 6 42762220 missense probably damaging 1.00
R1210:Olfr38 UTSW 6 42762667 missense possibly damaging 0.79
R1368:Olfr38 UTSW 6 42762679 missense possibly damaging 0.91
R2383:Olfr38 UTSW 6 42762459 missense probably benign 0.44
R4614:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4616:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R5121:Olfr38 UTSW 6 42762997 nonsense probably null
R5951:Olfr38 UTSW 6 42762559 missense probably damaging 1.00
R6061:Olfr38 UTSW 6 42762965 missense probably damaging 0.99
R6336:Olfr38 UTSW 6 42762657 missense probably damaging 1.00
R7414:Olfr38 UTSW 6 42762828 missense probably damaging 1.00
X0018:Olfr38 UTSW 6 42762935 missense probably damaging 0.99
Z1177:Olfr38 UTSW 6 42762207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGGTGGATGCATCTTATG -3'
(R):5'- GGTGTCATAAGCAAGACAATGC -3'

Sequencing Primer
(F):5'- AGCATAGTCCCCCAGCTG -3'
(R):5'- GCAATCTTGTTAGATGAGGTATCCAC -3'
Posted On2016-03-01