Incidental Mutation 'R4845:Arhgap21'
ID372086
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 042458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R4845 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20881187 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 393 (N393I)
Ref Sequence ENSEMBL: ENSMUSP00000133851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114594
AA Change: N397I

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: N397I

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141298
AA Change: N403I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: N403I

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154230
AA Change: N403I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: N403I

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173194
AA Change: N393I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: N393I

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174584
AA Change: N232I

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: N232I

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,748 D305E probably benign Het
Abcg1 C T 17: 31,114,083 S600F possibly damaging Het
Atp5j T A 16: 84,831,477 I6F possibly damaging Het
B4galt6 A G 18: 20,688,460 L337S probably benign Het
C8b G T 4: 104,791,812 V308F possibly damaging Het
Cables1 A G 18: 11,944,488 R558G probably damaging Het
Chmp2b T A 16: 65,550,976 Q38L probably damaging Het
Clca3b A T 3: 144,825,270 I773K probably benign Het
Cnmd T C 14: 79,662,008 T2A probably benign Het
Crb1 C T 1: 139,243,034 D812N probably benign Het
Dnah7c T A 1: 46,793,532 D3901E probably damaging Het
Dst T C 1: 34,193,127 V3445A probably benign Het
Epn1 T A 7: 5,093,909 I230N possibly damaging Het
Exoc6b G T 6: 84,835,137 D627E probably benign Het
Exosc1 T C 19: 41,931,358 K74E possibly damaging Het
Extl3 T C 14: 65,077,575 T53A probably benign Het
Fam227a C T 15: 79,649,711 R17H probably damaging Het
Faxc G T 4: 21,993,358 W334L probably damaging Het
Gabrr3 T C 16: 59,426,470 I94T probably damaging Het
Ifi203 A T 1: 173,927,029 M298K probably benign Het
Igkv4-78 A T 6: 69,060,223 M1K probably null Het
Iqcm G T 8: 75,746,352 R273I probably damaging Het
Itga1 G T 13: 114,974,172 S961* probably null Het
Jmy T A 13: 93,439,738 M886L possibly damaging Het
Lrp2 T C 2: 69,509,241 T1109A possibly damaging Het
Mastl A G 2: 23,139,998 S239P probably benign Het
Mettl14 T A 3: 123,371,355 E112V probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Musk A G 4: 58,296,679 D93G probably damaging Het
Myoc C T 1: 162,647,465 T195M possibly damaging Het
Ncapg2 A G 12: 116,440,588 D893G probably damaging Het
Nrap C T 19: 56,351,470 V908M probably benign Het
Olfr1009 T A 2: 85,721,492 L29* probably null Het
Olfr1252 T C 2: 89,721,776 I112V probably benign Het
Olfr669 T C 7: 104,939,363 V279A possibly damaging Het
Orc4 T C 2: 48,909,466 N333S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 G A 18: 37,356,718 G483D probably benign Het
Pclo A T 5: 14,679,118 probably benign Het
Ppm1k A T 6: 57,522,768 Y174* probably null Het
Ptprq A T 10: 107,653,532 S911T probably benign Het
Rp1 C A 1: 4,349,228 A554S probably benign Het
Sema3f T C 9: 107,685,501 Y427C probably damaging Het
Slc12a1 A T 2: 125,188,226 I573F probably damaging Het
Slc17a1 A T 13: 23,876,618 Y201F probably damaging Het
Slc4a7 A T 14: 14,733,803 H71L probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tab1 C T 15: 80,152,763 R217W probably damaging Het
Taf6 T A 5: 138,182,647 Y224F possibly damaging Het
Tmc5 C G 7: 118,642,381 F432L probably damaging Het
Trbc1 A T 6: 41,539,235 probably benign Het
Trbv21 A G 6: 41,202,945 N65S probably benign Het
Trim15 G A 17: 36,866,983 P40L probably benign Het
Txnip T C 3: 96,559,600 S197P probably benign Het
Vmn1r167 T A 7: 23,504,733 Q286L probably benign Het
Wnt9a A G 11: 59,331,241 I322V probably benign Het
Zfp879 T C 11: 50,833,845 E128G probably damaging Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R3877:Arhgap21 UTSW 2 20859906 missense probably damaging 0.99
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
R7237:Arhgap21 UTSW 2 20849972 nonsense probably null
R7261:Arhgap21 UTSW 2 20880366 missense probably benign
R7558:Arhgap21 UTSW 2 20855610 missense probably damaging 1.00
R7566:Arhgap21 UTSW 2 20912291 missense probably benign 0.17
R7738:Arhgap21 UTSW 2 20849479 missense probably damaging 1.00
R7738:Arhgap21 UTSW 2 20850358 missense probably damaging 1.00
R7820:Arhgap21 UTSW 2 20863172 missense probably damaging 1.00
R7822:Arhgap21 UTSW 2 20880713 missense possibly damaging 0.80
R7965:Arhgap21 UTSW 2 20849196 missense probably damaging 1.00
R7986:Arhgap21 UTSW 2 20863156 missense probably damaging 1.00
R8028:Arhgap21 UTSW 2 20880405 missense probably benign 0.02
R8209:Arhgap21 UTSW 2 20871745 missense probably damaging 1.00
R8226:Arhgap21 UTSW 2 20871745 missense probably damaging 1.00
R8251:Arhgap21 UTSW 2 20849410 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTCCTGAGATACACTGCG -3'
(R):5'- GATTCATCAGACCACAGGCTC -3'

Sequencing Primer
(F):5'- TGAGATACACTGCGCTGCC -3'
(R):5'- AGGCTCCAGATCCTTAGAACCTTC -3'
Posted On2016-03-01