Incidental Mutation 'R4845:Clca3b'
ID372097
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission 042458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4845 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144825270 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 773 (I773K)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: I773K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: I773K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,748 D305E probably benign Het
Abcg1 C T 17: 31,114,083 S600F possibly damaging Het
Arhgap21 T A 2: 20,881,187 N393I probably damaging Het
Atp5j T A 16: 84,831,477 I6F possibly damaging Het
B4galt6 A G 18: 20,688,460 L337S probably benign Het
C8b G T 4: 104,791,812 V308F possibly damaging Het
Cables1 A G 18: 11,944,488 R558G probably damaging Het
Chmp2b T A 16: 65,550,976 Q38L probably damaging Het
Cnmd T C 14: 79,662,008 T2A probably benign Het
Crb1 C T 1: 139,243,034 D812N probably benign Het
Dnah7c T A 1: 46,793,532 D3901E probably damaging Het
Dst T C 1: 34,193,127 V3445A probably benign Het
Epn1 T A 7: 5,093,909 I230N possibly damaging Het
Exoc6b G T 6: 84,835,137 D627E probably benign Het
Exosc1 T C 19: 41,931,358 K74E possibly damaging Het
Extl3 T C 14: 65,077,575 T53A probably benign Het
Fam227a C T 15: 79,649,711 R17H probably damaging Het
Faxc G T 4: 21,993,358 W334L probably damaging Het
Gabrr3 T C 16: 59,426,470 I94T probably damaging Het
Ifi203 A T 1: 173,927,029 M298K probably benign Het
Igkv4-78 A T 6: 69,060,223 M1K probably null Het
Iqcm G T 8: 75,746,352 R273I probably damaging Het
Itga1 G T 13: 114,974,172 S961* probably null Het
Jmy T A 13: 93,439,738 M886L possibly damaging Het
Lrp2 T C 2: 69,509,241 T1109A possibly damaging Het
Mastl A G 2: 23,139,998 S239P probably benign Het
Mettl14 T A 3: 123,371,355 E112V probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Musk A G 4: 58,296,679 D93G probably damaging Het
Myoc C T 1: 162,647,465 T195M possibly damaging Het
Ncapg2 A G 12: 116,440,588 D893G probably damaging Het
Nrap C T 19: 56,351,470 V908M probably benign Het
Olfr1009 T A 2: 85,721,492 L29* probably null Het
Olfr1252 T C 2: 89,721,776 I112V probably benign Het
Olfr669 T C 7: 104,939,363 V279A possibly damaging Het
Orc4 T C 2: 48,909,466 N333S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 G A 18: 37,356,718 G483D probably benign Het
Pclo A T 5: 14,679,118 probably benign Het
Ppm1k A T 6: 57,522,768 Y174* probably null Het
Ptprq A T 10: 107,653,532 S911T probably benign Het
Rp1 C A 1: 4,349,228 A554S probably benign Het
Sema3f T C 9: 107,685,501 Y427C probably damaging Het
Slc12a1 A T 2: 125,188,226 I573F probably damaging Het
Slc17a1 A T 13: 23,876,618 Y201F probably damaging Het
Slc4a7 A T 14: 14,733,803 H71L probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tab1 C T 15: 80,152,763 R217W probably damaging Het
Taf6 T A 5: 138,182,647 Y224F possibly damaging Het
Tmc5 C G 7: 118,642,381 F432L probably damaging Het
Trbc1 A T 6: 41,539,235 probably benign Het
Trbv21 A G 6: 41,202,945 N65S probably benign Het
Trim15 G A 17: 36,866,983 P40L probably benign Het
Txnip T C 3: 96,559,600 S197P probably benign Het
Vmn1r167 T A 7: 23,504,733 Q286L probably benign Het
Wnt9a A G 11: 59,331,241 I322V probably benign Het
Zfp879 T C 11: 50,833,845 E128G probably damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
R8546:Clca3b UTSW 3 144827397 missense probably damaging 0.99
R8716:Clca3b UTSW 3 144844594 missense probably benign 0.14
R8804:Clca3b UTSW 3 144839137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGCTTGTATCTTTTGAAGTTTC -3'
(R):5'- TTGTACTGAATCCACCCAGAC -3'

Sequencing Primer
(F):5'- GGGGTGTCTTTCATAACACT -3'
(R):5'- GACCGGAAATCCCAGAAGC -3'
Posted On2016-03-01