Incidental Mutation 'R4845:Ncapg2'
ID372120
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
MMRRC Submission 042458-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4845 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116440588 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 893 (D893G)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
Predicted Effect probably damaging
Transcript: ENSMUST00000084828
AA Change: D893G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: D893G

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,748 D305E probably benign Het
Abcg1 C T 17: 31,114,083 S600F possibly damaging Het
Arhgap21 T A 2: 20,881,187 N393I probably damaging Het
Atp5j T A 16: 84,831,477 I6F possibly damaging Het
B4galt6 A G 18: 20,688,460 L337S probably benign Het
C8b G T 4: 104,791,812 V308F possibly damaging Het
Cables1 A G 18: 11,944,488 R558G probably damaging Het
Chmp2b T A 16: 65,550,976 Q38L probably damaging Het
Clca3b A T 3: 144,825,270 I773K probably benign Het
Cnmd T C 14: 79,662,008 T2A probably benign Het
Crb1 C T 1: 139,243,034 D812N probably benign Het
Dnah7c T A 1: 46,793,532 D3901E probably damaging Het
Dst T C 1: 34,193,127 V3445A probably benign Het
Epn1 T A 7: 5,093,909 I230N possibly damaging Het
Exoc6b G T 6: 84,835,137 D627E probably benign Het
Exosc1 T C 19: 41,931,358 K74E possibly damaging Het
Extl3 T C 14: 65,077,575 T53A probably benign Het
Fam227a C T 15: 79,649,711 R17H probably damaging Het
Faxc G T 4: 21,993,358 W334L probably damaging Het
Gabrr3 T C 16: 59,426,470 I94T probably damaging Het
Ifi203 A T 1: 173,927,029 M298K probably benign Het
Igkv4-78 A T 6: 69,060,223 M1K probably null Het
Iqcm G T 8: 75,746,352 R273I probably damaging Het
Itga1 G T 13: 114,974,172 S961* probably null Het
Jmy T A 13: 93,439,738 M886L possibly damaging Het
Lrp2 T C 2: 69,509,241 T1109A possibly damaging Het
Mastl A G 2: 23,139,998 S239P probably benign Het
Mettl14 T A 3: 123,371,355 E112V probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Musk A G 4: 58,296,679 D93G probably damaging Het
Myoc C T 1: 162,647,465 T195M possibly damaging Het
Nrap C T 19: 56,351,470 V908M probably benign Het
Olfr1009 T A 2: 85,721,492 L29* probably null Het
Olfr1252 T C 2: 89,721,776 I112V probably benign Het
Olfr669 T C 7: 104,939,363 V279A possibly damaging Het
Orc4 T C 2: 48,909,466 N333S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 G A 18: 37,356,718 G483D probably benign Het
Pclo A T 5: 14,679,118 probably benign Het
Ppm1k A T 6: 57,522,768 Y174* probably null Het
Ptprq A T 10: 107,653,532 S911T probably benign Het
Rp1 C A 1: 4,349,228 A554S probably benign Het
Sema3f T C 9: 107,685,501 Y427C probably damaging Het
Slc12a1 A T 2: 125,188,226 I573F probably damaging Het
Slc17a1 A T 13: 23,876,618 Y201F probably damaging Het
Slc4a7 A T 14: 14,733,803 H71L probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tab1 C T 15: 80,152,763 R217W probably damaging Het
Taf6 T A 5: 138,182,647 Y224F possibly damaging Het
Tmc5 C G 7: 118,642,381 F432L probably damaging Het
Trbc1 A T 6: 41,539,235 probably benign Het
Trbv21 A G 6: 41,202,945 N65S probably benign Het
Trim15 G A 17: 36,866,983 P40L probably benign Het
Txnip T C 3: 96,559,600 S197P probably benign Het
Vmn1r167 T A 7: 23,504,733 Q286L probably benign Het
Wnt9a A G 11: 59,331,241 I322V probably benign Het
Zfp879 T C 11: 50,833,845 E128G probably damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116426577 missense probably benign
R8132:Ncapg2 UTSW 12 116444347 missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116412416 missense probably benign 0.00
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116438605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATCACATCTTGGAGAGGCTTTG -3'
(R):5'- TCTCTGAACCTGCTAGCTGC -3'

Sequencing Primer
(F):5'- AGAGGCTTTGTGGGCTTGAC -3'
(R):5'- AAAGCCAGTGTGTGTTACTTGGAAC -3'
Posted On2016-03-01