Incidental Mutation 'R4845:Jmy'
ID372122
Institutional Source Beutler Lab
Gene Symbol Jmy
Ensembl Gene ENSMUSG00000021690
Gene Namejunction-mediating and regulatory protein
Synonyms
MMRRC Submission 042458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4845 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93430101-93499808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93439738 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 886 (M886L)
Ref Sequence ENSEMBL: ENSMUSP00000070339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065537
AA Change: M886L

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070339
Gene: ENSMUSG00000021690
AA Change: M886L

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 55 6.2e-30 PFAM
low complexity region 77 94 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 152 181 N/A INTRINSIC
low complexity region 202 217 N/A INTRINSIC
Pfam:JMY 220 574 2.2e-175 PFAM
SCOP:d1jvr__ 794 816 4e-3 SMART
WH2 916 933 2.21e-2 SMART
low complexity region 964 975 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,748 D305E probably benign Het
Abcg1 C T 17: 31,114,083 S600F possibly damaging Het
Arhgap21 T A 2: 20,881,187 N393I probably damaging Het
Atp5j T A 16: 84,831,477 I6F possibly damaging Het
B4galt6 A G 18: 20,688,460 L337S probably benign Het
C8b G T 4: 104,791,812 V308F possibly damaging Het
Cables1 A G 18: 11,944,488 R558G probably damaging Het
Chmp2b T A 16: 65,550,976 Q38L probably damaging Het
Clca3b A T 3: 144,825,270 I773K probably benign Het
Cnmd T C 14: 79,662,008 T2A probably benign Het
Crb1 C T 1: 139,243,034 D812N probably benign Het
Dnah7c T A 1: 46,793,532 D3901E probably damaging Het
Dst T C 1: 34,193,127 V3445A probably benign Het
Epn1 T A 7: 5,093,909 I230N possibly damaging Het
Exoc6b G T 6: 84,835,137 D627E probably benign Het
Exosc1 T C 19: 41,931,358 K74E possibly damaging Het
Extl3 T C 14: 65,077,575 T53A probably benign Het
Fam227a C T 15: 79,649,711 R17H probably damaging Het
Faxc G T 4: 21,993,358 W334L probably damaging Het
Gabrr3 T C 16: 59,426,470 I94T probably damaging Het
Ifi203 A T 1: 173,927,029 M298K probably benign Het
Igkv4-78 A T 6: 69,060,223 M1K probably null Het
Iqcm G T 8: 75,746,352 R273I probably damaging Het
Itga1 G T 13: 114,974,172 S961* probably null Het
Lrp2 T C 2: 69,509,241 T1109A possibly damaging Het
Mastl A G 2: 23,139,998 S239P probably benign Het
Mettl14 T A 3: 123,371,355 E112V probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Musk A G 4: 58,296,679 D93G probably damaging Het
Myoc C T 1: 162,647,465 T195M possibly damaging Het
Ncapg2 A G 12: 116,440,588 D893G probably damaging Het
Nrap C T 19: 56,351,470 V908M probably benign Het
Olfr1009 T A 2: 85,721,492 L29* probably null Het
Olfr1252 T C 2: 89,721,776 I112V probably benign Het
Olfr669 T C 7: 104,939,363 V279A possibly damaging Het
Orc4 T C 2: 48,909,466 N333S probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb8 G A 18: 37,356,718 G483D probably benign Het
Pclo A T 5: 14,679,118 probably benign Het
Ppm1k A T 6: 57,522,768 Y174* probably null Het
Ptprq A T 10: 107,653,532 S911T probably benign Het
Rp1 C A 1: 4,349,228 A554S probably benign Het
Sema3f T C 9: 107,685,501 Y427C probably damaging Het
Slc12a1 A T 2: 125,188,226 I573F probably damaging Het
Slc17a1 A T 13: 23,876,618 Y201F probably damaging Het
Slc4a7 A T 14: 14,733,803 H71L probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Tab1 C T 15: 80,152,763 R217W probably damaging Het
Taf6 T A 5: 138,182,647 Y224F possibly damaging Het
Tmc5 C G 7: 118,642,381 F432L probably damaging Het
Trbc1 A T 6: 41,539,235 probably benign Het
Trbv21 A G 6: 41,202,945 N65S probably benign Het
Trim15 G A 17: 36,866,983 P40L probably benign Het
Txnip T C 3: 96,559,600 S197P probably benign Het
Vmn1r167 T A 7: 23,504,733 Q286L probably benign Het
Wnt9a A G 11: 59,331,241 I322V probably benign Het
Zfp879 T C 11: 50,833,845 E128G probably damaging Het
Other mutations in Jmy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Jmy APN 13 93441402 missense probably benign 0.00
IGL00949:Jmy APN 13 93454002 missense probably damaging 1.00
IGL01111:Jmy APN 13 93441021 missense probably damaging 1.00
IGL01734:Jmy APN 13 93459651 missense probably damaging 1.00
IGL01926:Jmy APN 13 93459786 missense probably damaging 1.00
IGL01985:Jmy APN 13 93459636 missense possibly damaging 0.58
IGL02183:Jmy APN 13 93499242 missense possibly damaging 0.78
IGL02517:Jmy APN 13 93452808 missense probably benign 0.01
IGL02524:Jmy APN 13 93472760 missense probably damaging 1.00
IGL02697:Jmy APN 13 93459701 nonsense probably null
IGL03024:Jmy APN 13 93499199 missense probably damaging 1.00
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0722:Jmy UTSW 13 93452817 missense probably benign 0.37
R1533:Jmy UTSW 13 93441311 missense probably benign
R1667:Jmy UTSW 13 93498370 missense probably damaging 1.00
R1737:Jmy UTSW 13 93498795 missense probably damaging 0.99
R1815:Jmy UTSW 13 93454077 missense probably damaging 1.00
R2057:Jmy UTSW 13 93459703 missense probably damaging 1.00
R3522:Jmy UTSW 13 93454050 missense probably damaging 1.00
R3765:Jmy UTSW 13 93464711 missense possibly damaging 0.78
R4231:Jmy UTSW 13 93498925 missense probably benign
R4279:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4279:Jmy UTSW 13 93499273 missense probably damaging 1.00
R4330:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4330:Jmy UTSW 13 93499273 missense probably damaging 1.00
R5047:Jmy UTSW 13 93441572 missense possibly damaging 0.65
R5403:Jmy UTSW 13 93441396 missense probably benign 0.08
R5941:Jmy UTSW 13 93498825 missense probably benign
R5953:Jmy UTSW 13 93499116 missense possibly damaging 0.62
R6022:Jmy UTSW 13 93453578 splice site probably null
R6150:Jmy UTSW 13 93441133 missense probably benign 0.10
R6520:Jmy UTSW 13 93454039 missense probably benign 0.10
R7073:Jmy UTSW 13 93441333 missense probably benign 0.01
R7074:Jmy UTSW 13 93453931 missense probably benign 0.15
R7325:Jmy UTSW 13 93472743 missense probably damaging 0.99
R7575:Jmy UTSW 13 93464595 nonsense probably null
R7641:Jmy UTSW 13 93442599 missense probably damaging 1.00
R7674:Jmy UTSW 13 93442599 missense probably damaging 1.00
R7862:Jmy UTSW 13 93499195 missense possibly damaging 0.75
R7945:Jmy UTSW 13 93499195 missense possibly damaging 0.75
Z1088:Jmy UTSW 13 93441081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCGGTATCAGGCAGAAG -3'
(R):5'- ATGGGAGTACATGGGGTGAT -3'

Sequencing Primer
(F):5'- GCAGAAGTGTGAAGGATTCTCTC -3'
(R):5'- GAACCTGGAGCTTACCGTTTCAG -3'
Posted On2016-03-01