Incidental Mutation 'R4846:Suco'
ID 372144
Institutional Source Beutler Lab
Gene Symbol Suco
Ensembl Gene ENSMUSG00000040297
Gene Name SUN domain containing ossification factor
Synonyms AI848100, osteopotentia, Opt
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.557) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 161643683-161704251 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 161661977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 818 (T818I)
Ref Sequence ENSEMBL: ENSMUSP00000044815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048377]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048377
AA Change: T818I

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297
AA Change: T818I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194388
Meta Mutation Damage Score 0.0780 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,393,392 (GRCm39) H299L probably damaging Het
Abcb4 C T 5: 8,985,180 (GRCm39) A687V probably benign Het
Abtb3 A G 10: 85,465,130 (GRCm39) T657A probably damaging Het
Adam20 A G 8: 41,248,048 (GRCm39) T53A probably benign Het
Afg1l G A 10: 42,330,490 (GRCm39) T59I probably benign Het
AI837181 A G 19: 5,476,329 (GRCm39) Q164R probably benign Het
Anapc15 T A 7: 101,546,974 (GRCm39) I12N probably benign Het
Ankrd55 A C 13: 112,499,988 (GRCm39) E278D probably benign Het
Axin2 A G 11: 108,833,125 (GRCm39) T437A probably benign Het
BC051665 T C 13: 60,931,895 (GRCm39) D168G probably damaging Het
Cd200 C T 16: 45,212,664 (GRCm39) R261H probably benign Het
Clk1 G A 1: 58,460,261 (GRCm39) S123L probably benign Het
Csrnp2 A T 15: 100,382,571 (GRCm39) D156E probably damaging Het
Ctss C T 3: 95,452,695 (GRCm39) Q159* probably null Het
Dennd2b C A 7: 109,156,043 (GRCm39) E236* probably null Het
Dip2a A G 10: 76,157,327 (GRCm39) S93P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ephb6 G A 6: 41,593,743 (GRCm39) R542Q probably benign Het
Fmo3 T C 1: 162,781,880 (GRCm39) D491G possibly damaging Het
Galnt14 A T 17: 73,843,888 (GRCm39) M140K probably benign Het
Ghsr T C 3: 27,425,986 (GRCm39) V14A probably benign Het
Gm17546 C A 15: 95,727,843 (GRCm39) probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hc A G 2: 34,909,682 (GRCm39) V866A probably benign Het
Hoxb6 G A 11: 96,190,348 (GRCm39) G116R probably damaging Het
Hykk A G 9: 54,827,890 (GRCm39) Y43C probably damaging Het
Jade2 T C 11: 51,711,975 (GRCm39) T495A probably benign Het
Kansl1 A T 11: 104,233,798 (GRCm39) V755E possibly damaging Het
Lrp2 T A 2: 69,309,457 (GRCm39) D2814V probably damaging Het
Mbd5 T A 2: 49,147,009 (GRCm39) N406K probably damaging Het
Met A T 6: 17,491,928 (GRCm39) D230V probably damaging Het
Mrgprx2 A T 7: 48,132,584 (GRCm39) V78D probably damaging Het
Mrpl20 A G 4: 155,892,993 (GRCm39) T112A possibly damaging Het
Nek11 T A 9: 105,040,362 (GRCm39) E566D probably damaging Het
Nostrin T C 2: 69,005,923 (GRCm39) S235P probably damaging Het
Npas4 C A 19: 5,036,805 (GRCm39) S453I probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Psg18 A T 7: 18,084,711 (GRCm39) Y128* probably null Het
Ptges3l A T 11: 101,310,010 (GRCm39) probably benign Het
Pus1 T C 5: 110,927,796 (GRCm39) probably benign Het
Raf1 T A 6: 115,621,544 (GRCm39) S12C possibly damaging Het
Rps6-ps2 T G 8: 89,533,206 (GRCm39) noncoding transcript Het
Slc5a4b A G 10: 75,898,073 (GRCm39) L547P probably damaging Het
Socs3 A G 11: 117,858,654 (GRCm39) S135P probably benign Het
Spata31d1e T C 13: 59,890,047 (GRCm39) D591G probably benign Het
Stra6l G A 4: 45,873,682 (GRCm39) V281M possibly damaging Het
Syde1 A T 10: 78,424,731 (GRCm39) V367D probably damaging Het
Tet3 A T 6: 83,353,865 (GRCm39) L932* probably null Het
Trpm7 G A 2: 126,655,105 (GRCm39) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,240,490 (GRCm39) T116S probably damaging Het
Wfdc6b A G 2: 164,459,214 (GRCm39) Q92R possibly damaging Het
Other mutations in Suco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Suco APN 1 161,661,689 (GRCm39) missense probably damaging 1.00
IGL01688:Suco APN 1 161,691,480 (GRCm39) splice site probably null
IGL01794:Suco APN 1 161,655,294 (GRCm39) missense probably benign 0.01
IGL01891:Suco APN 1 161,666,371 (GRCm39) missense probably damaging 1.00
IGL02028:Suco APN 1 161,684,428 (GRCm39) missense possibly damaging 0.95
IGL02102:Suco APN 1 161,655,274 (GRCm39) missense probably damaging 1.00
IGL02351:Suco APN 1 161,646,195 (GRCm39) missense probably benign 0.35
IGL02358:Suco APN 1 161,646,195 (GRCm39) missense probably benign 0.35
IGL02392:Suco APN 1 161,662,136 (GRCm39) missense probably benign 0.11
IGL02638:Suco APN 1 161,655,256 (GRCm39) missense probably damaging 1.00
IGL02650:Suco APN 1 161,676,322 (GRCm39) splice site probably benign
IGL03106:Suco APN 1 161,662,049 (GRCm39) missense possibly damaging 0.91
IGL03189:Suco APN 1 161,684,906 (GRCm39) unclassified probably benign
IGL03328:Suco APN 1 161,647,990 (GRCm39) missense probably damaging 0.99
girth UTSW 1 161,655,809 (GRCm39) missense possibly damaging 0.86
pleasingly UTSW 1 161,661,977 (GRCm39) missense possibly damaging 0.65
3-1:Suco UTSW 1 161,649,600 (GRCm39) intron probably benign
H8562:Suco UTSW 1 161,680,420 (GRCm39) missense probably damaging 1.00
H8786:Suco UTSW 1 161,680,420 (GRCm39) missense probably damaging 1.00
R0023:Suco UTSW 1 161,673,154 (GRCm39) splice site probably null
R0023:Suco UTSW 1 161,673,154 (GRCm39) splice site probably null
R0179:Suco UTSW 1 161,703,874 (GRCm39) splice site probably benign
R0299:Suco UTSW 1 161,681,379 (GRCm39) missense probably benign
R0418:Suco UTSW 1 161,662,419 (GRCm39) missense probably benign 0.11
R0481:Suco UTSW 1 161,689,882 (GRCm39) unclassified probably benign
R0610:Suco UTSW 1 161,691,601 (GRCm39) splice site probably benign
R0610:Suco UTSW 1 161,687,072 (GRCm39) missense probably benign
R0634:Suco UTSW 1 161,666,373 (GRCm39) missense possibly damaging 0.77
R0645:Suco UTSW 1 161,661,683 (GRCm39) missense probably damaging 1.00
R1276:Suco UTSW 1 161,685,025 (GRCm39) missense probably benign 0.10
R1720:Suco UTSW 1 161,661,623 (GRCm39) missense probably damaging 1.00
R1739:Suco UTSW 1 161,655,224 (GRCm39) critical splice donor site probably null
R1763:Suco UTSW 1 161,662,518 (GRCm39) missense possibly damaging 0.80
R1835:Suco UTSW 1 161,687,069 (GRCm39) nonsense probably null
R1988:Suco UTSW 1 161,646,380 (GRCm39) critical splice acceptor site probably null
R2939:Suco UTSW 1 161,676,220 (GRCm39) missense probably damaging 1.00
R3773:Suco UTSW 1 161,671,565 (GRCm39) splice site probably null
R3882:Suco UTSW 1 161,662,313 (GRCm39) missense probably benign 0.33
R4193:Suco UTSW 1 161,691,528 (GRCm39) missense probably benign 0.32
R4367:Suco UTSW 1 161,674,799 (GRCm39) missense probably damaging 1.00
R4397:Suco UTSW 1 161,672,421 (GRCm39) missense probably damaging 1.00
R4851:Suco UTSW 1 161,661,761 (GRCm39) missense probably damaging 1.00
R5224:Suco UTSW 1 161,662,274 (GRCm39) missense probably benign 0.06
R5329:Suco UTSW 1 161,660,999 (GRCm39) missense probably damaging 0.99
R6133:Suco UTSW 1 161,662,752 (GRCm39) nonsense probably null
R6632:Suco UTSW 1 161,655,809 (GRCm39) missense possibly damaging 0.86
R6643:Suco UTSW 1 161,687,001 (GRCm39) missense possibly damaging 0.71
R7378:Suco UTSW 1 161,689,780 (GRCm39) missense possibly damaging 0.76
R7405:Suco UTSW 1 161,655,783 (GRCm39) missense possibly damaging 0.65
R7509:Suco UTSW 1 161,672,903 (GRCm39) missense probably damaging 1.00
R7838:Suco UTSW 1 161,656,890 (GRCm39) missense probably benign 0.07
R7867:Suco UTSW 1 161,665,365 (GRCm39) missense possibly damaging 0.77
R7895:Suco UTSW 1 161,672,937 (GRCm39) splice site probably null
R8440:Suco UTSW 1 161,679,907 (GRCm39) missense probably damaging 1.00
R8453:Suco UTSW 1 161,650,586 (GRCm39) intron probably benign
R8781:Suco UTSW 1 161,645,951 (GRCm39) missense probably damaging 1.00
R8798:Suco UTSW 1 161,648,004 (GRCm39) missense probably damaging 1.00
R9292:Suco UTSW 1 161,671,574 (GRCm39) missense probably damaging 1.00
R9310:Suco UTSW 1 161,684,427 (GRCm39) missense probably damaging 1.00
R9380:Suco UTSW 1 161,646,074 (GRCm39) missense possibly damaging 0.61
R9411:Suco UTSW 1 161,666,356 (GRCm39) missense probably damaging 0.99
R9542:Suco UTSW 1 161,661,668 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGGCATCCTCTGGAGAC -3'
(R):5'- ACTGTCTAAAGTAGAAGGATCTGAG -3'

Sequencing Primer
(F):5'- GGCATCCTCTGGAGACTGTTC -3'
(R):5'- CTGAGTCTGTTAAATCTGAAGGAGG -3'
Posted On 2016-03-01