Incidental Mutation 'R4846:Hc'
ID 372146
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Name hemolytic complement
Synonyms C5, Hfib2, He, C5a
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 34873343-34951450 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34909682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 866 (V866A)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
AlphaFold P06684
PDB Structure Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028233
AA Change: V866A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: V866A

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156412
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,393,392 (GRCm39) H299L probably damaging Het
Abcb4 C T 5: 8,985,180 (GRCm39) A687V probably benign Het
Abtb3 A G 10: 85,465,130 (GRCm39) T657A probably damaging Het
Adam20 A G 8: 41,248,048 (GRCm39) T53A probably benign Het
Afg1l G A 10: 42,330,490 (GRCm39) T59I probably benign Het
AI837181 A G 19: 5,476,329 (GRCm39) Q164R probably benign Het
Anapc15 T A 7: 101,546,974 (GRCm39) I12N probably benign Het
Ankrd55 A C 13: 112,499,988 (GRCm39) E278D probably benign Het
Axin2 A G 11: 108,833,125 (GRCm39) T437A probably benign Het
BC051665 T C 13: 60,931,895 (GRCm39) D168G probably damaging Het
Cd200 C T 16: 45,212,664 (GRCm39) R261H probably benign Het
Clk1 G A 1: 58,460,261 (GRCm39) S123L probably benign Het
Csrnp2 A T 15: 100,382,571 (GRCm39) D156E probably damaging Het
Ctss C T 3: 95,452,695 (GRCm39) Q159* probably null Het
Dennd2b C A 7: 109,156,043 (GRCm39) E236* probably null Het
Dip2a A G 10: 76,157,327 (GRCm39) S93P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ephb6 G A 6: 41,593,743 (GRCm39) R542Q probably benign Het
Fmo3 T C 1: 162,781,880 (GRCm39) D491G possibly damaging Het
Galnt14 A T 17: 73,843,888 (GRCm39) M140K probably benign Het
Ghsr T C 3: 27,425,986 (GRCm39) V14A probably benign Het
Gm17546 C A 15: 95,727,843 (GRCm39) probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hoxb6 G A 11: 96,190,348 (GRCm39) G116R probably damaging Het
Hykk A G 9: 54,827,890 (GRCm39) Y43C probably damaging Het
Jade2 T C 11: 51,711,975 (GRCm39) T495A probably benign Het
Kansl1 A T 11: 104,233,798 (GRCm39) V755E possibly damaging Het
Lrp2 T A 2: 69,309,457 (GRCm39) D2814V probably damaging Het
Mbd5 T A 2: 49,147,009 (GRCm39) N406K probably damaging Het
Met A T 6: 17,491,928 (GRCm39) D230V probably damaging Het
Mrgprx2 A T 7: 48,132,584 (GRCm39) V78D probably damaging Het
Mrpl20 A G 4: 155,892,993 (GRCm39) T112A possibly damaging Het
Nek11 T A 9: 105,040,362 (GRCm39) E566D probably damaging Het
Nostrin T C 2: 69,005,923 (GRCm39) S235P probably damaging Het
Npas4 C A 19: 5,036,805 (GRCm39) S453I probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Psg18 A T 7: 18,084,711 (GRCm39) Y128* probably null Het
Ptges3l A T 11: 101,310,010 (GRCm39) probably benign Het
Pus1 T C 5: 110,927,796 (GRCm39) probably benign Het
Raf1 T A 6: 115,621,544 (GRCm39) S12C possibly damaging Het
Rps6-ps2 T G 8: 89,533,206 (GRCm39) noncoding transcript Het
Slc5a4b A G 10: 75,898,073 (GRCm39) L547P probably damaging Het
Socs3 A G 11: 117,858,654 (GRCm39) S135P probably benign Het
Spata31d1e T C 13: 59,890,047 (GRCm39) D591G probably benign Het
Stra6l G A 4: 45,873,682 (GRCm39) V281M possibly damaging Het
Suco G A 1: 161,661,977 (GRCm39) T818I possibly damaging Het
Syde1 A T 10: 78,424,731 (GRCm39) V367D probably damaging Het
Tet3 A T 6: 83,353,865 (GRCm39) L932* probably null Het
Trpm7 G A 2: 126,655,105 (GRCm39) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,240,490 (GRCm39) T116S probably damaging Het
Wfdc6b A G 2: 164,459,214 (GRCm39) Q92R possibly damaging Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34,881,641 (GRCm39) missense probably benign 0.00
IGL00922:Hc APN 2 34,881,680 (GRCm39) missense probably damaging 1.00
IGL01523:Hc APN 2 34,929,250 (GRCm39) missense probably benign 0.04
IGL01746:Hc APN 2 34,947,338 (GRCm39) missense probably damaging 0.98
IGL01793:Hc APN 2 34,918,202 (GRCm39) missense probably damaging 1.00
IGL01972:Hc APN 2 34,873,784 (GRCm39) missense probably damaging 1.00
IGL02037:Hc APN 2 34,903,531 (GRCm39) missense probably benign 0.16
IGL02048:Hc APN 2 34,886,039 (GRCm39) missense probably benign 0.00
IGL02227:Hc APN 2 34,899,923 (GRCm39) intron probably benign
IGL02230:Hc APN 2 34,903,682 (GRCm39) missense probably benign
IGL02254:Hc APN 2 34,874,836 (GRCm39) missense probably damaging 1.00
IGL02363:Hc APN 2 34,890,847 (GRCm39) missense probably benign
IGL02650:Hc APN 2 34,890,886 (GRCm39) missense possibly damaging 0.49
IGL03053:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03168:Hc APN 2 34,914,210 (GRCm39) missense probably benign 0.07
IGL03341:Hc APN 2 34,893,389 (GRCm39) missense probably damaging 0.98
PIT4142001:Hc UTSW 2 34,921,833 (GRCm39) splice site probably benign
PIT4378001:Hc UTSW 2 34,921,876 (GRCm39) missense probably benign 0.13
PIT4508001:Hc UTSW 2 34,874,816 (GRCm39) missense probably damaging 0.96
PIT4812001:Hc UTSW 2 34,919,464 (GRCm39) missense probably benign 0.16
R0025:Hc UTSW 2 34,876,304 (GRCm39) missense probably damaging 1.00
R0053:Hc UTSW 2 34,947,287 (GRCm39) missense probably benign 0.32
R0197:Hc UTSW 2 34,874,762 (GRCm39) missense probably damaging 1.00
R0218:Hc UTSW 2 34,918,086 (GRCm39) missense probably damaging 1.00
R0242:Hc UTSW 2 34,926,166 (GRCm39) splice site probably benign
R0496:Hc UTSW 2 34,903,583 (GRCm39) missense probably damaging 1.00
R1205:Hc UTSW 2 34,893,536 (GRCm39) missense possibly damaging 0.50
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1468:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R1574:Hc UTSW 2 34,890,777 (GRCm39) intron probably benign
R1610:Hc UTSW 2 34,896,173 (GRCm39) missense probably benign 0.44
R1640:Hc UTSW 2 34,947,336 (GRCm39) nonsense probably null
R1887:Hc UTSW 2 34,924,623 (GRCm39) missense probably benign
R1920:Hc UTSW 2 34,919,407 (GRCm39) splice site probably benign
R2018:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2019:Hc UTSW 2 34,903,540 (GRCm39) missense probably damaging 1.00
R2151:Hc UTSW 2 34,881,115 (GRCm39) intron probably benign
R2366:Hc UTSW 2 34,903,648 (GRCm39) missense probably benign
R4093:Hc UTSW 2 34,873,819 (GRCm39) nonsense probably null
R4288:Hc UTSW 2 34,920,414 (GRCm39) missense probably damaging 0.98
R4501:Hc UTSW 2 34,887,488 (GRCm39) splice site probably null
R4502:Hc UTSW 2 34,896,264 (GRCm39) missense probably benign 0.00
R4508:Hc UTSW 2 34,903,077 (GRCm39) missense possibly damaging 0.94
R4583:Hc UTSW 2 34,918,189 (GRCm39) missense probably benign 0.00
R4686:Hc UTSW 2 34,929,260 (GRCm39) missense possibly damaging 0.49
R4776:Hc UTSW 2 34,929,746 (GRCm39) missense probably benign 0.12
R5032:Hc UTSW 2 34,903,544 (GRCm39) missense probably benign 0.07
R5089:Hc UTSW 2 34,914,902 (GRCm39) missense probably benign 0.01
R5289:Hc UTSW 2 34,886,026 (GRCm39) critical splice donor site probably null
R5347:Hc UTSW 2 34,927,636 (GRCm39) missense probably benign 0.04
R5356:Hc UTSW 2 34,885,007 (GRCm39) missense probably benign 0.00
R5379:Hc UTSW 2 34,881,077 (GRCm39) missense probably damaging 1.00
R5403:Hc UTSW 2 34,947,446 (GRCm39) missense probably damaging 1.00
R5418:Hc UTSW 2 34,898,195 (GRCm39) critical splice donor site probably null
R5450:Hc UTSW 2 34,903,050 (GRCm39) missense possibly damaging 0.67
R5494:Hc UTSW 2 34,893,551 (GRCm39) splice site probably null
R5713:Hc UTSW 2 34,903,543 (GRCm39) missense probably damaging 0.99
R5898:Hc UTSW 2 34,887,449 (GRCm39) missense probably benign 0.06
R5925:Hc UTSW 2 34,920,462 (GRCm39) missense possibly damaging 0.92
R5942:Hc UTSW 2 34,918,137 (GRCm39) nonsense probably null
R5991:Hc UTSW 2 34,896,117 (GRCm39) missense possibly damaging 0.91
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6036:Hc UTSW 2 34,929,696 (GRCm39) missense probably benign 0.00
R6115:Hc UTSW 2 34,903,050 (GRCm39) missense probably damaging 1.00
R6234:Hc UTSW 2 34,918,058 (GRCm39) missense probably benign
R6264:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
R6313:Hc UTSW 2 34,879,851 (GRCm39) splice site probably null
R6525:Hc UTSW 2 34,881,236 (GRCm39) missense probably benign 0.06
R6577:Hc UTSW 2 34,922,138 (GRCm39) missense probably benign 0.00
R6601:Hc UTSW 2 34,935,906 (GRCm39) missense probably benign 0.03
R6916:Hc UTSW 2 34,900,044 (GRCm39) nonsense probably null
R7108:Hc UTSW 2 34,929,706 (GRCm39) missense probably benign 0.03
R7143:Hc UTSW 2 34,940,450 (GRCm39) missense probably benign 0.00
R7388:Hc UTSW 2 34,874,859 (GRCm39) splice site probably null
R7468:Hc UTSW 2 34,918,063 (GRCm39) missense probably benign 0.00
R7504:Hc UTSW 2 34,951,331 (GRCm39) missense not run
R7521:Hc UTSW 2 34,935,344 (GRCm39) missense possibly damaging 0.80
R7582:Hc UTSW 2 34,881,278 (GRCm39) missense possibly damaging 0.70
R7596:Hc UTSW 2 34,890,859 (GRCm39) missense probably damaging 0.96
R7599:Hc UTSW 2 34,940,431 (GRCm39) missense probably damaging 1.00
R7692:Hc UTSW 2 34,914,161 (GRCm39) missense probably damaging 1.00
R7853:Hc UTSW 2 34,900,045 (GRCm39) missense probably damaging 1.00
R7877:Hc UTSW 2 34,887,411 (GRCm39) nonsense probably null
R8329:Hc UTSW 2 34,902,910 (GRCm39) splice site probably null
R8375:Hc UTSW 2 34,873,731 (GRCm39) missense probably benign 0.32
R8477:Hc UTSW 2 34,879,182 (GRCm39) missense probably damaging 1.00
R8810:Hc UTSW 2 34,909,535 (GRCm39) missense probably benign 0.06
R8888:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8895:Hc UTSW 2 34,890,861 (GRCm39) missense probably benign 0.00
R8968:Hc UTSW 2 34,922,317 (GRCm39) missense possibly damaging 0.91
R8969:Hc UTSW 2 34,909,475 (GRCm39) critical splice donor site probably null
R9146:Hc UTSW 2 34,924,571 (GRCm39) missense probably damaging 1.00
R9218:Hc UTSW 2 34,922,203 (GRCm39) missense probably damaging 1.00
R9340:Hc UTSW 2 34,876,294 (GRCm39) missense probably damaging 0.99
R9396:Hc UTSW 2 34,927,615 (GRCm39) nonsense probably null
R9569:Hc UTSW 2 34,926,359 (GRCm39) missense probably benign 0.00
R9576:Hc UTSW 2 34,873,767 (GRCm39) missense probably benign 0.01
R9706:Hc UTSW 2 34,914,196 (GRCm39) missense probably damaging 1.00
X0066:Hc UTSW 2 34,873,723 (GRCm39) missense probably damaging 1.00
Z1088:Hc UTSW 2 34,919,482 (GRCm39) missense probably benign 0.02
Z1088:Hc UTSW 2 34,898,261 (GRCm39) missense possibly damaging 0.94
Z1176:Hc UTSW 2 34,896,285 (GRCm39) critical splice acceptor site probably null
Z1177:Hc UTSW 2 34,903,622 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTTTCCCAAATGAGGTCTC -3'
(R):5'- TTGAACTTGCTAAGAAACCAGGG -3'

Sequencing Primer
(F):5'- TCCCAAATGAGGTCTCTAGTGAG -3'
(R):5'- TGTGTCCAGACCAGCATAATTCAGG -3'
Posted On 2016-03-01