Mutagenetix > Incidental Mutation

Incidental Mutation 'R4846:Mbd5'

372147

Institutional Source

Beutler Lab

Gene Symbol

Mbd5

Ensembl Gene

ENSMUSG00000036792

Gene Name

methyl-CpG binding domain protein 5

Synonyms

C030040A15Rik, OTTMUSG00000012483, 9430004D19Rik

MMRRC Submission

042459-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48949508-49325405 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49256997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 406 (N406K)

Ref Sequence

ENSEMBL: ENSMUSP00000108365 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112745] [ENSMUST00000112754]

AlphaFold

B1AYB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000047413
AA Change: N406K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: N406K

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Blast:MBD	24	77	9e-11	BLAST
low complexity region	332	342	N/A	INTRINSIC
low complexity region	429	443	N/A	INTRINSIC
low complexity region	459	467	N/A	INTRINSIC
low complexity region	499	512	N/A	INTRINSIC
low complexity region	535	546	N/A	INTRINSIC
low complexity region	571	613	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
low complexity region	912	932	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
low complexity region	992	1010	N/A	INTRINSIC
low complexity region	1020	1035	N/A	INTRINSIC
low complexity region	1112	1136	N/A	INTRINSIC
low complexity region	1173	1184	N/A	INTRINSIC
low complexity region	1206	1229	N/A	INTRINSIC
low complexity region	1552	1562	N/A	INTRINSIC
SCOP:d1khca_	1615	1718	2e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112745
AA Change: N406K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108365
Gene: ENSMUSG00000036792
AA Change: N406K

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Blast:MBD	24	77	4e-11	BLAST
low complexity region	332	342	N/A	INTRINSIC
low complexity region	429	443	N/A	INTRINSIC
low complexity region	459	467	N/A	INTRINSIC
low complexity region	499	512	N/A	INTRINSIC
low complexity region	535	546	N/A	INTRINSIC
low complexity region	571	613	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112754
AA Change: N406K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: N406K

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Blast:MBD	24	77	8e-11	BLAST
low complexity region	332	342	N/A	INTRINSIC
low complexity region	429	443	N/A	INTRINSIC
low complexity region	459	467	N/A	INTRINSIC
low complexity region	499	512	N/A	INTRINSIC
low complexity region	535	546	N/A	INTRINSIC
low complexity region	571	613	N/A	INTRINSIC
low complexity region	699	719	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
low complexity region	912	932	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
low complexity region	976	999	N/A	INTRINSIC
low complexity region	1322	1332	N/A	INTRINSIC
SCOP:d1khca_	1385	1488	4e-17	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000122841
AA Change: N145K

SMART Domains

Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: N145K

Domain	Start	End	E-Value	Type
low complexity region	72	82	N/A	INTRINSIC
low complexity region	169	183	N/A	INTRINSIC
low complexity region	199	207	N/A	INTRINSIC
low complexity region	239	252	N/A	INTRINSIC
low complexity region	275	286	N/A	INTRINSIC
low complexity region	311	353	N/A	INTRINSIC
low complexity region	439	459	N/A	INTRINSIC
low complexity region	581	592	N/A	INTRINSIC
low complexity region	652	672	N/A	INTRINSIC
low complexity region	674	688	N/A	INTRINSIC
low complexity region	732	750	N/A	INTRINSIC
low complexity region	760	775	N/A	INTRINSIC
low complexity region	852	876	N/A	INTRINSIC
low complexity region	913	924	N/A	INTRINSIC
low complexity region	946	969	N/A	INTRINSIC
low complexity region	1011	1022	N/A	INTRINSIC
low complexity region	1056	1064	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000199257

Meta Mutation Damage Score

0.0642

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,233	D591G	probably benign	Het
9930012K11Rik	T	A	14: 70,155,943	H299L	probably damaging	Het
Abcb4	C	T	5: 8,935,180	A687V	probably benign	Het
Adam20	A	G	8: 40,795,011	T53A	probably benign	Het
Afg1l	G	A	10: 42,454,494	T59I	probably benign	Het
AI837181	A	G	19: 5,426,301	Q164R	probably benign	Het
Anapc15	T	A	7: 101,897,767	I12N	probably benign	Het
Ankrd55	A	C	13: 112,363,454	E278D	probably benign	Het
Axin2	A	G	11: 108,942,299	T437A	probably benign	Het
BC051665	T	C	13: 60,784,081	D168G	probably damaging	Het
Btbd11	A	G	10: 85,629,266	T657A	probably damaging	Het
Cd200	C	T	16: 45,392,301	R261H	probably benign	Het
Clk1	G	A	1: 58,421,102	S123L	probably benign	Het
Csrnp2	A	T	15: 100,484,690	D156E	probably damaging	Het
Ctss	C	T	3: 95,545,384	Q159*	probably null	Het
Dip2a	A	G	10: 76,321,493	S93P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ephb6	G	A	6: 41,616,809	R542Q	probably benign	Het
Fmo3	T	C	1: 162,954,311	D491G	possibly damaging	Het
Galnt14	A	T	17: 73,536,893	M140K	probably benign	Het
Ghsr	T	C	3: 27,371,837	V14A	probably benign	Het
Gm17546	C	A	15: 95,829,962		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hc	A	G	2: 35,019,670	V866A	probably benign	Het
Hoxb6	G	A	11: 96,299,522	G116R	probably damaging	Het
Hykk	A	G	9: 54,920,606	Y43C	probably damaging	Het
Jade2	T	C	11: 51,821,148	T495A	probably benign	Het
Kansl1	A	T	11: 104,342,972	V755E	possibly damaging	Het
Lrp2	T	A	2: 69,479,113	D2814V	probably damaging	Het
Met	A	T	6: 17,491,929	D230V	probably damaging	Het
Mrgprx2	A	T	7: 48,482,836	V78D	probably damaging	Het
Mrpl20	A	G	4: 155,808,536	T112A	possibly damaging	Het
Nek11	T	A	9: 105,163,163	E566D	probably damaging	Het
Nostrin	T	C	2: 69,175,579	S235P	probably damaging	Het
Npas4	C	A	19: 4,986,777	S453I	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Psg18	A	T	7: 18,350,786	Y128*	probably null	Het
Ptges3l	A	T	11: 101,419,184		probably benign	Het
Pus1	T	C	5: 110,779,930		probably benign	Het
Raf1	T	A	6: 115,644,583	S12C	possibly damaging	Het
Rps6-ps2	T	G	8: 88,806,578		noncoding transcript	Het
Slc5a4b	A	G	10: 76,062,239	L547P	probably damaging	Het
Socs3	A	G	11: 117,967,828	S135P	probably benign	Het
St5	C	A	7: 109,556,836	E236*	probably null	Het
Stra6l	G	A	4: 45,873,682	V281M	possibly damaging	Het
Suco	G	A	1: 161,834,408	T818I	possibly damaging	Het
Syde1	A	T	10: 78,588,897	V367D	probably damaging	Het
Tet3	A	T	6: 83,376,883	L932*	probably null	Het
Trpm7	G	A	2: 126,813,185	L1278F	possibly damaging	Het
Vmn1r168	A	T	7: 23,541,065	T116S	probably damaging	Het
Wfdc6b	A	G	2: 164,617,294	Q92R	possibly damaging	Het

Other mutations in Mbd5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01385:Mbd5	APN	2	49250221	missense	possibly damaging	0.92
IGL01481:Mbd5	APN	2	49278939	missense	possibly damaging	0.90
IGL01639:Mbd5	APN	2	49272308	missense	probably damaging	0.98
IGL02063:Mbd5	APN	2	49274767	missense	probably damaging	1.00
IGL02157:Mbd5	APN	2	49278975	missense	probably benign
IGL02510:Mbd5	APN	2	49257029	missense	probably benign	0.05
IGL02932:Mbd5	APN	2	49279448	missense	possibly damaging	0.66
IGL02973:Mbd5	APN	2	49313709	missense	probably damaging	0.99
IGL03189:Mbd5	APN	2	49257751	missense	probably damaging	0.98
BB003:Mbd5	UTSW	2	49256323	missense	probably damaging	0.99
BB013:Mbd5	UTSW	2	49256323	missense	probably damaging	0.99
F5770:Mbd5	UTSW	2	49316410	missense	probably damaging	0.99
R0391:Mbd5	UTSW	2	49272416	missense	possibly damaging	0.90
R0427:Mbd5	UTSW	2	49279079	missense	probably benign	0.27
R0544:Mbd5	UTSW	2	49257209	missense	possibly damaging	0.54
R0883:Mbd5	UTSW	2	49256689	missense	possibly damaging	0.94
R1072:Mbd5	UTSW	2	49257191	missense	probably damaging	1.00
R1099:Mbd5	UTSW	2	49258144	missense	probably benign	0.06
R1400:Mbd5	UTSW	2	49274776	critical splice donor site	probably null
R1497:Mbd5	UTSW	2	49257381	missense	possibly damaging	0.73
R1552:Mbd5	UTSW	2	49272934	missense	probably damaging	0.99
R1675:Mbd5	UTSW	2	49256218	missense	possibly damaging	0.90
R1710:Mbd5	UTSW	2	49257032	missense	probably benign	0.10
R2085:Mbd5	UTSW	2	49279311	missense	possibly damaging	0.90
R2252:Mbd5	UTSW	2	49257686	missense	probably damaging	1.00
R2473:Mbd5	UTSW	2	49279341	missense	probably benign	0.06
R3966:Mbd5	UTSW	2	49272070	missense	possibly damaging	0.46
R4278:Mbd5	UTSW	2	49272293	missense	probably damaging	0.97
R4348:Mbd5	UTSW	2	49256327	missense	probably benign
R4366:Mbd5	UTSW	2	49272966	missense	probably damaging	0.99
R4428:Mbd5	UTSW	2	49279764	missense	possibly damaging	0.94
R4556:Mbd5	UTSW	2	49279394	missense	probably damaging	1.00
R4600:Mbd5	UTSW	2	49257197	missense	probably benign	0.31
R4689:Mbd5	UTSW	2	49258279	missense	possibly damaging	0.46
R4707:Mbd5	UTSW	2	49250156	missense	probably damaging	0.99
R4718:Mbd5	UTSW	2	49256402	missense	possibly damaging	0.66
R4773:Mbd5	UTSW	2	49274611	missense	probably damaging	1.00
R5015:Mbd5	UTSW	2	49258196	missense	possibly damaging	0.92
R5059:Mbd5	UTSW	2	49256455	missense	probably damaging	0.96
R5268:Mbd5	UTSW	2	49272094	missense	possibly damaging	0.92
R5479:Mbd5	UTSW	2	49272905	missense	probably damaging	0.99
R5579:Mbd5	UTSW	2	49272814	missense	possibly damaging	0.94
R5591:Mbd5	UTSW	2	49274669	missense	probably damaging	1.00
R5876:Mbd5	UTSW	2	49274645	missense	probably damaging	0.98
R5886:Mbd5	UTSW	2	49272452	missense	probably damaging	1.00
R5973:Mbd5	UTSW	2	49272389	missense	probably benign	0.23
R6935:Mbd5	UTSW	2	49279812	missense	probably damaging	0.97
R7317:Mbd5	UTSW	2	49279743	missense	probably benign
R7366:Mbd5	UTSW	2	49274568	missense	probably benign
R7385:Mbd5	UTSW	2	49272449	missense	probably benign	0.01
R7402:Mbd5	UTSW	2	49257554	missense	probably damaging	1.00
R7462:Mbd5	UTSW	2	49257880	missense	possibly damaging	0.52
R7549:Mbd5	UTSW	2	49251343	missense	probably damaging	0.97
R7916:Mbd5	UTSW	2	49257106	missense	probably damaging	0.99
R7926:Mbd5	UTSW	2	49256323	missense	probably damaging	0.99
R7960:Mbd5	UTSW	2	49279784	critical splice donor site	probably null
R8273:Mbd5	UTSW	2	49278879	missense	probably damaging	0.99
R8909:Mbd5	UTSW	2	49279221	missense	probably benign	0.13
R9121:Mbd5	UTSW	2	49258090	missense	possibly damaging	0.59
R9149:Mbd5	UTSW	2	49251376	missense	probably damaging	0.98
R9443:Mbd5	UTSW	2	49256700	missense	probably damaging	0.99
R9506:Mbd5	UTSW	2	49272907	missense	probably damaging	0.96
R9566:Mbd5	UTSW	2	49279509	missense	probably damaging	0.96
R9756:Mbd5	UTSW	2	49279271	missense	probably benign	0.07
V7583:Mbd5	UTSW	2	49316410	missense	probably damaging	0.99
Z1176:Mbd5	UTSW	2	49279308	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TACCACGAGCAATGTTCCAC -3'
(R):5'- TGTGGAAGATGAGCGTGATC -3'

Sequencing Primer
(F):5'- CTTGTGCTCTTCAGAAAAAGCC -3'
(R):5'- AAGATGAGCGTGATCTTTGGG -3'

Posted On

2016-03-01