Incidental Mutation 'R4846:Wfdc6b'
ID372151
Institutional Source Beutler Lab
Gene Symbol Wfdc6b
Ensembl Gene ENSMUSG00000070531
Gene NameWAP four-disulfide core domain 6B
SynonymsWfdc6
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164613522-164618212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164617294 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 92 (Q92R)
Ref Sequence ENSEMBL: ENSMUSP00000091906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094346] [ENSMUST00000094351] [ENSMUST00000109338] [ENSMUST00000109339]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094346
AA Change: Q92R

PolyPhen 2 Score 0.531 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091906
Gene: ENSMUSG00000070531
AA Change: Q92R

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
WAP 42 84 2.99e-1 SMART
KU 86 139 7.78e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094351
SMART Domains Protein: ENSMUSP00000091911
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104483
Predicted Effect probably benign
Transcript: ENSMUST00000109338
SMART Domains Protein: ENSMUSP00000104962
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
WAP 229 272 1.84e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109339
SMART Domains Protein: ENSMUSP00000104963
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
low complexity region 300 313 N/A INTRINSIC
low complexity region 384 393 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Other mutations in Wfdc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02874:Wfdc6b APN 2 164617448 critical splice donor site probably null
R0031:Wfdc6b UTSW 2 164613859 missense probably damaging 1.00
R0975:Wfdc6b UTSW 2 164613785 missense probably damaging 1.00
R2118:Wfdc6b UTSW 2 164617443 missense probably benign 0.18
R2124:Wfdc6b UTSW 2 164617443 missense probably benign 0.18
R3619:Wfdc6b UTSW 2 164614906 missense probably benign 0.00
R4746:Wfdc6b UTSW 2 164617433 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTGATACTTTGTGTTACCATCC -3'
(R):5'- GACCAGTGCTATGATGGCTG -3'

Sequencing Primer
(F):5'- GATACTTTGTGTTACCATCCTGAAG -3'
(R):5'- ACCAGTGCTATGATGGCTGATTAGAC -3'
Posted On2016-03-01