Incidental Mutation 'R4846:Mrpl20'
ID 372156
Institutional Source Beutler Lab
Gene Symbol Mrpl20
Ensembl Gene ENSMUSG00000029066
Gene Name mitochondrial ribosomal protein L20
Synonyms 2610008D01Rik, 4930425I20Rik
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.942) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 155887335-155893288 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155892993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000139122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030942] [ENSMUST00000030944] [ENSMUST00000130188] [ENSMUST00000137487] [ENSMUST00000185148]
AlphaFold Q9CQL4
Predicted Effect possibly damaging
Transcript: ENSMUST00000030942
AA Change: T112A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030942
Gene: ENSMUSG00000029066
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 11 116 2.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030944
SMART Domains Protein: ENSMUSP00000030944
Gene: ENSMUSG00000029068

DomainStartEndE-ValueType
low complexity region 1 30 N/A INTRINSIC
CYCLIN 81 183 8.74e-11 SMART
Cyclin_C 192 315 9.58e-5 SMART
CYCLIN 196 280 1.24e-15 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 376 428 N/A INTRINSIC
Blast:CYCLIN 429 478 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126346
SMART Domains Protein: ENSMUSP00000116000
Gene: ENSMUSG00000029068

DomainStartEndE-ValueType
Blast:CYCLIN 2 52 2e-28 BLAST
SCOP:d1vin_1 29 59 9e-4 SMART
SCOP:d1jkw_2 62 87 8e-4 SMART
Blast:CYCLIN 65 87 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129850
Predicted Effect probably benign
Transcript: ENSMUST00000130188
SMART Domains Protein: ENSMUSP00000139007
Gene: ENSMUSG00000029066

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 94 6.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136370
Predicted Effect possibly damaging
Transcript: ENSMUST00000137487
AA Change: T112A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139122
Gene: ENSMUSG00000029066
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 116 1.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143503
Predicted Effect probably benign
Transcript: ENSMUST00000185148
AA Change: T75A

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139169
Gene: ENSMUSG00000029066
AA Change: T75A

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 79 1.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184339
Meta Mutation Damage Score 0.1367 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 21q. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,393,392 (GRCm39) H299L probably damaging Het
Abcb4 C T 5: 8,985,180 (GRCm39) A687V probably benign Het
Abtb3 A G 10: 85,465,130 (GRCm39) T657A probably damaging Het
Adam20 A G 8: 41,248,048 (GRCm39) T53A probably benign Het
Afg1l G A 10: 42,330,490 (GRCm39) T59I probably benign Het
AI837181 A G 19: 5,476,329 (GRCm39) Q164R probably benign Het
Anapc15 T A 7: 101,546,974 (GRCm39) I12N probably benign Het
Ankrd55 A C 13: 112,499,988 (GRCm39) E278D probably benign Het
Axin2 A G 11: 108,833,125 (GRCm39) T437A probably benign Het
BC051665 T C 13: 60,931,895 (GRCm39) D168G probably damaging Het
Cd200 C T 16: 45,212,664 (GRCm39) R261H probably benign Het
Clk1 G A 1: 58,460,261 (GRCm39) S123L probably benign Het
Csrnp2 A T 15: 100,382,571 (GRCm39) D156E probably damaging Het
Ctss C T 3: 95,452,695 (GRCm39) Q159* probably null Het
Dennd2b C A 7: 109,156,043 (GRCm39) E236* probably null Het
Dip2a A G 10: 76,157,327 (GRCm39) S93P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ephb6 G A 6: 41,593,743 (GRCm39) R542Q probably benign Het
Fmo3 T C 1: 162,781,880 (GRCm39) D491G possibly damaging Het
Galnt14 A T 17: 73,843,888 (GRCm39) M140K probably benign Het
Ghsr T C 3: 27,425,986 (GRCm39) V14A probably benign Het
Gm17546 C A 15: 95,727,843 (GRCm39) probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hc A G 2: 34,909,682 (GRCm39) V866A probably benign Het
Hoxb6 G A 11: 96,190,348 (GRCm39) G116R probably damaging Het
Hykk A G 9: 54,827,890 (GRCm39) Y43C probably damaging Het
Jade2 T C 11: 51,711,975 (GRCm39) T495A probably benign Het
Kansl1 A T 11: 104,233,798 (GRCm39) V755E possibly damaging Het
Lrp2 T A 2: 69,309,457 (GRCm39) D2814V probably damaging Het
Mbd5 T A 2: 49,147,009 (GRCm39) N406K probably damaging Het
Met A T 6: 17,491,928 (GRCm39) D230V probably damaging Het
Mrgprx2 A T 7: 48,132,584 (GRCm39) V78D probably damaging Het
Nek11 T A 9: 105,040,362 (GRCm39) E566D probably damaging Het
Nostrin T C 2: 69,005,923 (GRCm39) S235P probably damaging Het
Npas4 C A 19: 5,036,805 (GRCm39) S453I probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Psg18 A T 7: 18,084,711 (GRCm39) Y128* probably null Het
Ptges3l A T 11: 101,310,010 (GRCm39) probably benign Het
Pus1 T C 5: 110,927,796 (GRCm39) probably benign Het
Raf1 T A 6: 115,621,544 (GRCm39) S12C possibly damaging Het
Rps6-ps2 T G 8: 89,533,206 (GRCm39) noncoding transcript Het
Slc5a4b A G 10: 75,898,073 (GRCm39) L547P probably damaging Het
Socs3 A G 11: 117,858,654 (GRCm39) S135P probably benign Het
Spata31d1e T C 13: 59,890,047 (GRCm39) D591G probably benign Het
Stra6l G A 4: 45,873,682 (GRCm39) V281M possibly damaging Het
Suco G A 1: 161,661,977 (GRCm39) T818I possibly damaging Het
Syde1 A T 10: 78,424,731 (GRCm39) V367D probably damaging Het
Tet3 A T 6: 83,353,865 (GRCm39) L932* probably null Het
Trpm7 G A 2: 126,655,105 (GRCm39) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,240,490 (GRCm39) T116S probably damaging Het
Wfdc6b A G 2: 164,459,214 (GRCm39) Q92R possibly damaging Het
Other mutations in Mrpl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Mrpl20 APN 4 155,893,041 (GRCm39) missense probably benign 0.00
R3055:Mrpl20 UTSW 4 155,888,329 (GRCm39) missense possibly damaging 0.89
R3056:Mrpl20 UTSW 4 155,888,329 (GRCm39) missense possibly damaging 0.89
R4082:Mrpl20 UTSW 4 155,892,970 (GRCm39) missense probably damaging 0.99
R5305:Mrpl20 UTSW 4 155,888,162 (GRCm39) missense probably damaging 1.00
R5779:Mrpl20 UTSW 4 155,891,378 (GRCm39) missense probably damaging 1.00
R6576:Mrpl20 UTSW 4 155,891,371 (GRCm39) missense probably benign 0.08
R9360:Mrpl20 UTSW 4 155,888,402 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAGCAGGCCTGGAACTTACAG -3'
(R):5'- TCACTGAATAAAGACCTGTCGTC -3'

Sequencing Primer
(F):5'- CTGGAACTTACAGGTTCTATGGTGC -3'
(R):5'- CTCAGGCCTGTTGCTAAAATG -3'
Posted On 2016-03-01