Incidental Mutation 'R4846:Mrpl20'
ID372156
Institutional Source Beutler Lab
Gene Symbol Mrpl20
Ensembl Gene ENSMUSG00000029066
Gene Namemitochondrial ribosomal protein L20
Synonyms2610008D01Rik, 4930425I20Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155802878-155809975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155808536 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000139122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030942] [ENSMUST00000030944] [ENSMUST00000130188] [ENSMUST00000137487] [ENSMUST00000185148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030942
AA Change: T112A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030942
Gene: ENSMUSG00000029066
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 11 116 2.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030944
SMART Domains Protein: ENSMUSP00000030944
Gene: ENSMUSG00000029068

DomainStartEndE-ValueType
low complexity region 1 30 N/A INTRINSIC
CYCLIN 81 183 8.74e-11 SMART
Cyclin_C 192 315 9.58e-5 SMART
CYCLIN 196 280 1.24e-15 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 376 428 N/A INTRINSIC
Blast:CYCLIN 429 478 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126346
SMART Domains Protein: ENSMUSP00000116000
Gene: ENSMUSG00000029068

DomainStartEndE-ValueType
Blast:CYCLIN 2 52 2e-28 BLAST
SCOP:d1vin_1 29 59 9e-4 SMART
SCOP:d1jkw_2 62 87 8e-4 SMART
Blast:CYCLIN 65 87 5e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129850
Predicted Effect probably benign
Transcript: ENSMUST00000130188
SMART Domains Protein: ENSMUSP00000139007
Gene: ENSMUSG00000029066

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 94 6.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136370
Predicted Effect possibly damaging
Transcript: ENSMUST00000137487
AA Change: T112A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139122
Gene: ENSMUSG00000029066
AA Change: T112A

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 116 1.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184339
Predicted Effect probably benign
Transcript: ENSMUST00000185148
AA Change: T75A

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139169
Gene: ENSMUSG00000029066
AA Change: T75A

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 79 1.5e-21 PFAM
Meta Mutation Damage Score 0.1367 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 21q. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Mrpl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Mrpl20 APN 4 155808584 missense probably benign 0.00
R3055:Mrpl20 UTSW 4 155803872 missense possibly damaging 0.89
R3056:Mrpl20 UTSW 4 155803872 missense possibly damaging 0.89
R4082:Mrpl20 UTSW 4 155808513 missense probably damaging 0.99
R5305:Mrpl20 UTSW 4 155803705 missense probably damaging 1.00
R5779:Mrpl20 UTSW 4 155806921 missense probably damaging 1.00
R6576:Mrpl20 UTSW 4 155806914 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTAGCAGGCCTGGAACTTACAG -3'
(R):5'- TCACTGAATAAAGACCTGTCGTC -3'

Sequencing Primer
(F):5'- CTGGAACTTACAGGTTCTATGGTGC -3'
(R):5'- CTCAGGCCTGTTGCTAAAATG -3'
Posted On2016-03-01