Incidental Mutation 'R4846:Abcb4'
ID 372157
Institutional Source Beutler Lab
Gene Symbol Abcb4
Ensembl Gene ENSMUSG00000042476
Gene Name ATP-binding cassette, sub-family B (MDR/TAP), member 4
Synonyms Pgy-2, Mdr2, Pgy2, mdr-2
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 8893717-8959231 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8935180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 687 (A687V)
Ref Sequence ENSEMBL: ENSMUSP00000142425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]
AlphaFold P21440
Predicted Effect probably benign
Transcript: ENSMUST00000003717
AA Change: A687V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: A687V

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 342 2e-94 PFAM
AAA 418 610 3.97e-20 SMART
Pfam:ABC_membrane 708 982 6.3e-77 PFAM
AAA 1058 1246 4.49e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196067
AA Change: A687V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: A687V

DomainStartEndE-ValueType
Pfam:ABC_membrane 54 344 2.4e-95 PFAM
AAA 418 610 6.2e-22 SMART
Pfam:ABC_membrane 708 882 1.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199954
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,155,943 (GRCm38) H299L probably damaging Het
Abtb3 A G 10: 85,629,266 (GRCm38) T657A probably damaging Het
Adam20 A G 8: 40,795,011 (GRCm38) T53A probably benign Het
Afg1l G A 10: 42,454,494 (GRCm38) T59I probably benign Het
AI837181 A G 19: 5,426,301 (GRCm38) Q164R probably benign Het
Anapc15 T A 7: 101,897,767 (GRCm38) I12N probably benign Het
Ankrd55 A C 13: 112,363,454 (GRCm38) E278D probably benign Het
Axin2 A G 11: 108,942,299 (GRCm38) T437A probably benign Het
BC051665 T C 13: 60,784,081 (GRCm38) D168G probably damaging Het
Cd200 C T 16: 45,392,301 (GRCm38) R261H probably benign Het
Clk1 G A 1: 58,421,102 (GRCm38) S123L probably benign Het
Csrnp2 A T 15: 100,484,690 (GRCm38) D156E probably damaging Het
Ctss C T 3: 95,545,384 (GRCm38) Q159* probably null Het
Dip2a A G 10: 76,321,493 (GRCm38) S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 (GRCm38) probably null Het
Dync1h1 C A 12: 110,658,126 (GRCm38) T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 (GRCm38) R542Q probably benign Het
Fmo3 T C 1: 162,954,311 (GRCm38) D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 (GRCm38) M140K probably benign Het
Ghsr T C 3: 27,371,837 (GRCm38) V14A probably benign Het
Gm17546 C A 15: 95,829,962 (GRCm38) probably benign Het
Gprc5c G T 11: 114,864,267 (GRCm38) V257L possibly damaging Het
Hc A G 2: 35,019,670 (GRCm38) V866A probably benign Het
Hoxb6 G A 11: 96,299,522 (GRCm38) G116R probably damaging Het
Hykk A G 9: 54,920,606 (GRCm38) Y43C probably damaging Het
Jade2 T C 11: 51,821,148 (GRCm38) T495A probably benign Het
Kansl1 A T 11: 104,342,972 (GRCm38) V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 (GRCm38) D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 (GRCm38) N406K probably damaging Het
Met A T 6: 17,491,929 (GRCm38) D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 (GRCm38) V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 (GRCm38) T112A possibly damaging Het
Nek11 T A 9: 105,163,163 (GRCm38) E566D probably damaging Het
Nostrin T C 2: 69,175,579 (GRCm38) S235P probably damaging Het
Npas4 C A 19: 4,986,777 (GRCm38) S453I probably benign Het
Pnkp C T 7: 44,862,403 (GRCm38) S113L probably damaging Het
Psg18 A T 7: 18,350,786 (GRCm38) Y128* probably null Het
Ptges3l A T 11: 101,419,184 (GRCm38) probably benign Het
Pus1 T C 5: 110,779,930 (GRCm38) probably benign Het
Raf1 T A 6: 115,644,583 (GRCm38) S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 (GRCm38) noncoding transcript Het
Slc5a4b A G 10: 76,062,239 (GRCm38) L547P probably damaging Het
Socs3 A G 11: 117,967,828 (GRCm38) S135P probably benign Het
Spata31d1e T C 13: 59,742,233 (GRCm38) D591G probably benign Het
St5 C A 7: 109,556,836 (GRCm38) E236* probably null Het
Stra6l G A 4: 45,873,682 (GRCm38) V281M possibly damaging Het
Suco G A 1: 161,834,408 (GRCm38) T818I possibly damaging Het
Syde1 A T 10: 78,588,897 (GRCm38) V367D probably damaging Het
Tet3 A T 6: 83,376,883 (GRCm38) L932* probably null Het
Trpm7 G A 2: 126,813,185 (GRCm38) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 (GRCm38) T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 (GRCm38) Q92R possibly damaging Het
Other mutations in Abcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Abcb4 APN 5 8,950,073 (GRCm38) missense probably benign 0.02
IGL00663:Abcb4 APN 5 8,927,916 (GRCm38) missense probably damaging 1.00
IGL00671:Abcb4 APN 5 8,930,745 (GRCm38) nonsense probably null
IGL00822:Abcb4 APN 5 8,950,046 (GRCm38) missense probably benign
IGL01080:Abcb4 APN 5 8,934,258 (GRCm38) missense probably damaging 1.00
IGL01152:Abcb4 APN 5 8,950,678 (GRCm38) missense probably benign 0.19
IGL01329:Abcb4 APN 5 8,894,166 (GRCm38) critical splice donor site probably null
IGL01483:Abcb4 APN 5 8,927,871 (GRCm38) missense probably damaging 0.99
IGL01594:Abcb4 APN 5 8,946,071 (GRCm38) splice site probably null
IGL01785:Abcb4 APN 5 8,915,058 (GRCm38) nonsense probably null
IGL01968:Abcb4 APN 5 8,927,913 (GRCm38) missense probably benign 0.33
IGL02579:Abcb4 APN 5 8,955,537 (GRCm38) missense probably damaging 1.00
IGL02654:Abcb4 APN 5 8,927,826 (GRCm38) missense possibly damaging 0.80
IGL02658:Abcb4 APN 5 8,934,240 (GRCm38) missense probably benign
IGL03229:Abcb4 APN 5 8,940,936 (GRCm38) missense probably damaging 0.97
IGL03335:Abcb4 APN 5 8,935,258 (GRCm38) missense probably benign 0.00
FR4737:Abcb4 UTSW 5 8,896,597 (GRCm38) small deletion probably benign
P0014:Abcb4 UTSW 5 8,950,083 (GRCm38) missense probably benign 0.01
R0102:Abcb4 UTSW 5 8,909,194 (GRCm38) missense probably damaging 0.99
R0102:Abcb4 UTSW 5 8,909,194 (GRCm38) missense probably damaging 0.99
R0309:Abcb4 UTSW 5 8,939,835 (GRCm38) missense probably damaging 1.00
R0311:Abcb4 UTSW 5 8,934,243 (GRCm38) missense probably benign
R0420:Abcb4 UTSW 5 8,941,050 (GRCm38) missense probably benign 0.03
R0449:Abcb4 UTSW 5 8,939,885 (GRCm38) nonsense probably null
R0609:Abcb4 UTSW 5 8,947,376 (GRCm38) missense probably damaging 0.96
R1459:Abcb4 UTSW 5 8,918,662 (GRCm38) missense possibly damaging 0.61
R1470:Abcb4 UTSW 5 8,940,968 (GRCm38) missense probably damaging 0.98
R1470:Abcb4 UTSW 5 8,940,968 (GRCm38) missense probably damaging 0.98
R1812:Abcb4 UTSW 5 8,928,578 (GRCm38) critical splice donor site probably null
R1944:Abcb4 UTSW 5 8,930,796 (GRCm38) missense probably damaging 1.00
R2002:Abcb4 UTSW 5 8,905,989 (GRCm38) missense probably benign 0.01
R2256:Abcb4 UTSW 5 8,958,431 (GRCm38) missense probably damaging 1.00
R3116:Abcb4 UTSW 5 8,896,610 (GRCm38) missense possibly damaging 0.86
R4112:Abcb4 UTSW 5 8,936,783 (GRCm38) critical splice acceptor site probably null
R4354:Abcb4 UTSW 5 8,918,771 (GRCm38) missense probably benign 0.44
R4512:Abcb4 UTSW 5 8,928,573 (GRCm38) missense probably damaging 1.00
R4588:Abcb4 UTSW 5 8,947,328 (GRCm38) missense probably benign 0.01
R4628:Abcb4 UTSW 5 8,907,399 (GRCm38) missense probably benign 0.08
R4708:Abcb4 UTSW 5 8,915,125 (GRCm38) missense possibly damaging 0.90
R4714:Abcb4 UTSW 5 8,930,906 (GRCm38) splice site probably null
R4754:Abcb4 UTSW 5 8,910,717 (GRCm38) missense probably damaging 1.00
R4896:Abcb4 UTSW 5 8,907,267 (GRCm38) missense possibly damaging 0.81
R4944:Abcb4 UTSW 5 8,934,327 (GRCm38) critical splice donor site probably null
R4994:Abcb4 UTSW 5 8,928,524 (GRCm38) missense probably damaging 1.00
R5022:Abcb4 UTSW 5 8,909,054 (GRCm38) splice site probably null
R5537:Abcb4 UTSW 5 8,955,485 (GRCm38) missense probably damaging 0.98
R5754:Abcb4 UTSW 5 8,934,320 (GRCm38) missense probably benign
R5833:Abcb4 UTSW 5 8,958,314 (GRCm38) missense probably damaging 1.00
R5934:Abcb4 UTSW 5 8,930,806 (GRCm38) missense probably benign 0.18
R6006:Abcb4 UTSW 5 8,946,026 (GRCm38) missense probably damaging 0.99
R6146:Abcb4 UTSW 5 8,896,587 (GRCm38) missense probably benign 0.05
R6183:Abcb4 UTSW 5 8,918,718 (GRCm38) missense probably benign
R6260:Abcb4 UTSW 5 8,934,219 (GRCm38) nonsense probably null
R6561:Abcb4 UTSW 5 8,927,825 (GRCm38) missense probably benign 0.14
R7016:Abcb4 UTSW 5 8,936,843 (GRCm38) missense probably benign 0.35
R7081:Abcb4 UTSW 5 8,934,263 (GRCm38) missense probably benign
R7326:Abcb4 UTSW 5 8,934,226 (GRCm38) missense probably benign 0.00
R7375:Abcb4 UTSW 5 8,918,671 (GRCm38) missense probably benign
R7787:Abcb4 UTSW 5 8,909,220 (GRCm38) missense probably damaging 1.00
R7836:Abcb4 UTSW 5 8,934,203 (GRCm38) missense probably benign
R8128:Abcb4 UTSW 5 8,958,395 (GRCm38) missense probably damaging 1.00
R8350:Abcb4 UTSW 5 8,928,578 (GRCm38) critical splice donor site probably null
R8438:Abcb4 UTSW 5 8,946,120 (GRCm38) critical splice donor site probably null
R8447:Abcb4 UTSW 5 8,907,278 (GRCm38) missense probably damaging 0.97
R8710:Abcb4 UTSW 5 8,955,495 (GRCm38) missense probably damaging 1.00
R8777:Abcb4 UTSW 5 8,939,894 (GRCm38) missense probably benign 0.01
R8777-TAIL:Abcb4 UTSW 5 8,939,894 (GRCm38) missense probably benign 0.01
R8837:Abcb4 UTSW 5 8,936,873 (GRCm38) missense probably damaging 0.99
R8987:Abcb4 UTSW 5 8,927,931 (GRCm38) missense probably benign 0.02
R9098:Abcb4 UTSW 5 8,958,441 (GRCm38) missense probably damaging 1.00
R9167:Abcb4 UTSW 5 8,936,849 (GRCm38) nonsense probably null
R9210:Abcb4 UTSW 5 8,955,591 (GRCm38) missense probably damaging 1.00
R9212:Abcb4 UTSW 5 8,955,591 (GRCm38) missense probably damaging 1.00
R9218:Abcb4 UTSW 5 8,927,960 (GRCm38) missense probably benign 0.20
R9242:Abcb4 UTSW 5 8,899,677 (GRCm38) missense probably damaging 1.00
R9376:Abcb4 UTSW 5 8,958,988 (GRCm38) missense probably damaging 1.00
R9476:Abcb4 UTSW 5 8,927,790 (GRCm38) missense probably damaging 1.00
RF015:Abcb4 UTSW 5 8,896,594 (GRCm38) frame shift probably null
RF047:Abcb4 UTSW 5 8,896,595 (GRCm38) frame shift probably null
Z1176:Abcb4 UTSW 5 8,959,005 (GRCm38) missense probably damaging 1.00
Z1177:Abcb4 UTSW 5 8,939,906 (GRCm38) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACCTGTGTGTAAGATTCATGC -3'
(R):5'- GCTATTAACCCCAGAATTGGTGG -3'

Sequencing Primer
(F):5'- GATTCATGCTCGACAGTAGGTAC -3'
(R):5'- CCAGAATTGGTGGGGCTTTAAC -3'
Posted On 2016-03-01