Incidental Mutation 'R4846:Met'
ID 372158
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Name met proto-oncogene
Synonyms Par4, HGF receptor, c-Met
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 17463799-17573979 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 17491928 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 230 (D230V)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443] [ENSMUST00000140070]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: D230V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: D230V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: D230V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: D230V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: D230V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: D230V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140070
SMART Domains Protein: ENSMUSP00000117856
Gene: ENSMUSG00000009376

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 52 169 4.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145473
Meta Mutation Damage Score 0.7881 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,393,392 (GRCm39) H299L probably damaging Het
Abcb4 C T 5: 8,985,180 (GRCm39) A687V probably benign Het
Abtb3 A G 10: 85,465,130 (GRCm39) T657A probably damaging Het
Adam20 A G 8: 41,248,048 (GRCm39) T53A probably benign Het
Afg1l G A 10: 42,330,490 (GRCm39) T59I probably benign Het
AI837181 A G 19: 5,476,329 (GRCm39) Q164R probably benign Het
Anapc15 T A 7: 101,546,974 (GRCm39) I12N probably benign Het
Ankrd55 A C 13: 112,499,988 (GRCm39) E278D probably benign Het
Axin2 A G 11: 108,833,125 (GRCm39) T437A probably benign Het
BC051665 T C 13: 60,931,895 (GRCm39) D168G probably damaging Het
Cd200 C T 16: 45,212,664 (GRCm39) R261H probably benign Het
Clk1 G A 1: 58,460,261 (GRCm39) S123L probably benign Het
Csrnp2 A T 15: 100,382,571 (GRCm39) D156E probably damaging Het
Ctss C T 3: 95,452,695 (GRCm39) Q159* probably null Het
Dennd2b C A 7: 109,156,043 (GRCm39) E236* probably null Het
Dip2a A G 10: 76,157,327 (GRCm39) S93P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ephb6 G A 6: 41,593,743 (GRCm39) R542Q probably benign Het
Fmo3 T C 1: 162,781,880 (GRCm39) D491G possibly damaging Het
Galnt14 A T 17: 73,843,888 (GRCm39) M140K probably benign Het
Ghsr T C 3: 27,425,986 (GRCm39) V14A probably benign Het
Gm17546 C A 15: 95,727,843 (GRCm39) probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hc A G 2: 34,909,682 (GRCm39) V866A probably benign Het
Hoxb6 G A 11: 96,190,348 (GRCm39) G116R probably damaging Het
Hykk A G 9: 54,827,890 (GRCm39) Y43C probably damaging Het
Jade2 T C 11: 51,711,975 (GRCm39) T495A probably benign Het
Kansl1 A T 11: 104,233,798 (GRCm39) V755E possibly damaging Het
Lrp2 T A 2: 69,309,457 (GRCm39) D2814V probably damaging Het
Mbd5 T A 2: 49,147,009 (GRCm39) N406K probably damaging Het
Mrgprx2 A T 7: 48,132,584 (GRCm39) V78D probably damaging Het
Mrpl20 A G 4: 155,892,993 (GRCm39) T112A possibly damaging Het
Nek11 T A 9: 105,040,362 (GRCm39) E566D probably damaging Het
Nostrin T C 2: 69,005,923 (GRCm39) S235P probably damaging Het
Npas4 C A 19: 5,036,805 (GRCm39) S453I probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Psg18 A T 7: 18,084,711 (GRCm39) Y128* probably null Het
Ptges3l A T 11: 101,310,010 (GRCm39) probably benign Het
Pus1 T C 5: 110,927,796 (GRCm39) probably benign Het
Raf1 T A 6: 115,621,544 (GRCm39) S12C possibly damaging Het
Rps6-ps2 T G 8: 89,533,206 (GRCm39) noncoding transcript Het
Slc5a4b A G 10: 75,898,073 (GRCm39) L547P probably damaging Het
Socs3 A G 11: 117,858,654 (GRCm39) S135P probably benign Het
Spata31d1e T C 13: 59,890,047 (GRCm39) D591G probably benign Het
Stra6l G A 4: 45,873,682 (GRCm39) V281M possibly damaging Het
Suco G A 1: 161,661,977 (GRCm39) T818I possibly damaging Het
Syde1 A T 10: 78,424,731 (GRCm39) V367D probably damaging Het
Tet3 A T 6: 83,353,865 (GRCm39) L932* probably null Het
Trpm7 G A 2: 126,655,105 (GRCm39) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,240,490 (GRCm39) T116S probably damaging Het
Wfdc6b A G 2: 164,459,214 (GRCm39) Q92R possibly damaging Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17,534,936 (GRCm39) unclassified probably benign
IGL01066:Met APN 6 17,535,104 (GRCm39) critical splice donor site probably null
IGL01344:Met APN 6 17,547,031 (GRCm39) missense probably benign 0.44
IGL01413:Met APN 6 17,558,895 (GRCm39) splice site probably benign
IGL01608:Met APN 6 17,558,729 (GRCm39) missense probably damaging 1.00
IGL01613:Met APN 6 17,540,576 (GRCm39) missense probably damaging 1.00
IGL01820:Met APN 6 17,534,230 (GRCm39) missense possibly damaging 0.89
IGL01843:Met APN 6 17,491,700 (GRCm39) missense probably damaging 1.00
IGL02014:Met APN 6 17,527,256 (GRCm39) splice site probably benign
IGL02027:Met APN 6 17,563,726 (GRCm39) splice site probably benign
IGL02243:Met APN 6 17,549,093 (GRCm39) missense probably damaging 1.00
IGL02373:Met APN 6 17,491,528 (GRCm39) missense probably damaging 1.00
IGL02616:Met APN 6 17,553,346 (GRCm39) missense probably damaging 1.00
IGL02702:Met APN 6 17,534,142 (GRCm39) missense possibly damaging 0.92
IGL02704:Met APN 6 17,491,256 (GRCm39) missense possibly damaging 0.62
IGL02714:Met APN 6 17,491,851 (GRCm39) nonsense probably null
IGL02936:Met APN 6 17,553,396 (GRCm39) missense probably damaging 1.00
IGL02943:Met APN 6 17,535,928 (GRCm39) missense possibly damaging 0.84
IGL03057:Met APN 6 17,558,765 (GRCm39) missense probably damaging 1.00
IGL03124:Met APN 6 17,492,077 (GRCm39) missense probably benign 0.27
IGL03171:Met APN 6 17,562,272 (GRCm39) splice site probably benign
IGL03266:Met APN 6 17,540,537 (GRCm39) missense possibly damaging 0.61
IGL03285:Met APN 6 17,553,336 (GRCm39) missense probably damaging 0.98
R0453:Met UTSW 6 17,534,197 (GRCm39) missense possibly damaging 0.88
R0543:Met UTSW 6 17,491,969 (GRCm39) missense probably damaging 1.00
R0601:Met UTSW 6 17,555,631 (GRCm39) splice site probably null
R0652:Met UTSW 6 17,491,709 (GRCm39) missense probably benign 0.00
R0941:Met UTSW 6 17,491,393 (GRCm39) missense probably damaging 1.00
R1142:Met UTSW 6 17,527,182 (GRCm39) nonsense probably null
R1553:Met UTSW 6 17,491,460 (GRCm39) missense probably benign 0.01
R1569:Met UTSW 6 17,531,503 (GRCm39) nonsense probably null
R1744:Met UTSW 6 17,540,645 (GRCm39) missense possibly damaging 0.47
R2224:Met UTSW 6 17,563,721 (GRCm39) splice site probably null
R2308:Met UTSW 6 17,491,741 (GRCm39) missense probably benign 0.00
R2369:Met UTSW 6 17,531,527 (GRCm39) missense probably benign 0.04
R2393:Met UTSW 6 17,534,197 (GRCm39) missense probably damaging 0.99
R2419:Met UTSW 6 17,535,829 (GRCm39) splice site probably benign
R2483:Met UTSW 6 17,549,085 (GRCm39) missense probably damaging 1.00
R2511:Met UTSW 6 17,491,966 (GRCm39) missense probably damaging 1.00
R3622:Met UTSW 6 17,549,085 (GRCm39) missense probably damaging 1.00
R3623:Met UTSW 6 17,549,085 (GRCm39) missense probably damaging 1.00
R3624:Met UTSW 6 17,549,085 (GRCm39) missense probably damaging 1.00
R4050:Met UTSW 6 17,533,983 (GRCm39) missense probably benign
R4051:Met UTSW 6 17,548,728 (GRCm39) missense possibly damaging 0.86
R4159:Met UTSW 6 17,562,271 (GRCm39) splice site probably null
R4208:Met UTSW 6 17,548,728 (GRCm39) missense possibly damaging 0.86
R4622:Met UTSW 6 17,513,383 (GRCm39) missense probably benign 0.19
R4672:Met UTSW 6 17,571,803 (GRCm39) missense probably benign 0.33
R4737:Met UTSW 6 17,491,540 (GRCm39) missense probably damaging 1.00
R4738:Met UTSW 6 17,491,540 (GRCm39) missense probably damaging 1.00
R4834:Met UTSW 6 17,491,412 (GRCm39) missense probably damaging 0.97
R4855:Met UTSW 6 17,558,796 (GRCm39) missense probably damaging 1.00
R4878:Met UTSW 6 17,549,058 (GRCm39) missense probably damaging 1.00
R4902:Met UTSW 6 17,546,995 (GRCm39) missense probably damaging 1.00
R5208:Met UTSW 6 17,526,422 (GRCm39) nonsense probably null
R5355:Met UTSW 6 17,491,361 (GRCm39) missense probably damaging 1.00
R5415:Met UTSW 6 17,527,084 (GRCm39) missense probably benign 0.01
R5556:Met UTSW 6 17,534,175 (GRCm39) missense probably benign 0.04
R5590:Met UTSW 6 17,548,781 (GRCm39) missense probably benign 0.00
R5683:Met UTSW 6 17,571,743 (GRCm39) missense probably damaging 1.00
R5872:Met UTSW 6 17,562,197 (GRCm39) missense probably damaging 1.00
R5891:Met UTSW 6 17,491,538 (GRCm39) missense probably benign 0.02
R5895:Met UTSW 6 17,531,581 (GRCm39) missense probably benign 0.02
R6063:Met UTSW 6 17,491,967 (GRCm39) missense probably damaging 1.00
R6262:Met UTSW 6 17,553,403 (GRCm39) missense probably benign 0.00
R6362:Met UTSW 6 17,558,732 (GRCm39) missense probably damaging 1.00
R6747:Met UTSW 6 17,571,466 (GRCm39) missense probably damaging 1.00
R6966:Met UTSW 6 17,531,531 (GRCm39) missense possibly damaging 0.65
R6989:Met UTSW 6 17,535,928 (GRCm39) missense probably damaging 1.00
R6989:Met UTSW 6 17,535,927 (GRCm39) missense possibly damaging 0.67
R7017:Met UTSW 6 17,491,286 (GRCm39) nonsense probably null
R7037:Met UTSW 6 17,547,127 (GRCm39) intron probably benign
R7141:Met UTSW 6 17,527,154 (GRCm39) missense probably benign 0.01
R7242:Met UTSW 6 17,491,316 (GRCm39) missense probably damaging 1.00
R7282:Met UTSW 6 17,547,011 (GRCm39) nonsense probably null
R7624:Met UTSW 6 17,558,834 (GRCm39) missense probably damaging 1.00
R7770:Met UTSW 6 17,491,406 (GRCm39) missense possibly damaging 0.79
R7797:Met UTSW 6 17,533,952 (GRCm39) missense probably damaging 1.00
R8082:Met UTSW 6 17,492,312 (GRCm39) missense probably damaging 0.98
R8109:Met UTSW 6 17,562,236 (GRCm39) missense probably damaging 1.00
R8162:Met UTSW 6 17,547,061 (GRCm39) missense probably damaging 0.98
R8315:Met UTSW 6 17,533,956 (GRCm39) missense probably damaging 0.99
R8325:Met UTSW 6 17,571,671 (GRCm39) missense probably damaging 1.00
R8348:Met UTSW 6 17,571,799 (GRCm39) missense probably benign 0.00
R8354:Met UTSW 6 17,491,768 (GRCm39) missense probably damaging 1.00
R8448:Met UTSW 6 17,571,799 (GRCm39) missense probably benign 0.00
R8454:Met UTSW 6 17,491,768 (GRCm39) missense probably damaging 1.00
R8465:Met UTSW 6 17,571,809 (GRCm39) missense probably benign 0.04
R8479:Met UTSW 6 17,491,746 (GRCm39) splice site probably null
R8737:Met UTSW 6 17,540,510 (GRCm39) missense probably benign 0.00
R8903:Met UTSW 6 17,549,137 (GRCm39) missense probably benign 0.19
R8964:Met UTSW 6 17,527,144 (GRCm39) missense probably damaging 1.00
R8998:Met UTSW 6 17,491,534 (GRCm39) missense probably benign 0.43
R9088:Met UTSW 6 17,548,715 (GRCm39) nonsense probably null
R9369:Met UTSW 6 17,492,228 (GRCm39) missense probably benign
R9394:Met UTSW 6 17,513,395 (GRCm39) missense probably damaging 1.00
R9530:Met UTSW 6 17,558,831 (GRCm39) missense probably damaging 1.00
R9564:Met UTSW 6 17,531,425 (GRCm39) missense probably benign
R9759:Met UTSW 6 17,555,561 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGTCCACTGCATGTTCTC -3'
(R):5'- GAGTGCAACCCAGAGTCTAC -3'

Sequencing Primer
(F):5'- ATGTTCTCCCCAGAAGAGGAGTC -3'
(R):5'- GTCTACGGAACAGAACCTGATTATTC -3'
Posted On 2016-03-01