Mutagenetix > Incidental Mutation

Incidental Mutation 'R4846:Met'

372158

Institutional Source

Beutler Lab

Gene Symbol

Met

Ensembl Gene

ENSMUSG00000009376

Gene Name

met proto-oncogene

Synonyms

Par4, HGF receptor, c-Met

MMRRC Submission

042459-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17463800-17573980 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 17491929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 230 (D230V)

Ref Sequence

ENSEMBL: ENSMUSP00000111103 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443] [ENSMUST00000140070]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080469
AA Change: D230V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: D230V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115442
AA Change: D230V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: D230V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000115443
AA Change: D230V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: D230V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Sema	52	495	4.5e-134	SMART
PSI	518	561	1.18e-9	SMART
IPT	561	654	9.43e-15	SMART
IPT	655	738	4.16e-25	SMART
IPT	740	835	3.38e-16	SMART
IPT	837	933	4.08e-10	SMART
TyrKc	1076	1335	7.65e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000140070

SMART Domains

Protein: ENSMUSP00000117856
Gene: ENSMUSG00000009376

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Sema	52	169	4.8e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145473

Meta Mutation Damage Score

0.7881

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,233	D591G	probably benign	Het
9930012K11Rik	T	A	14: 70,155,943	H299L	probably damaging	Het
Abcb4	C	T	5: 8,935,180	A687V	probably benign	Het
Adam20	A	G	8: 40,795,011	T53A	probably benign	Het
Afg1l	G	A	10: 42,454,494	T59I	probably benign	Het
AI837181	A	G	19: 5,426,301	Q164R	probably benign	Het
Anapc15	T	A	7: 101,897,767	I12N	probably benign	Het
Ankrd55	A	C	13: 112,363,454	E278D	probably benign	Het
Axin2	A	G	11: 108,942,299	T437A	probably benign	Het
BC051665	T	C	13: 60,784,081	D168G	probably damaging	Het
Btbd11	A	G	10: 85,629,266	T657A	probably damaging	Het
Cd200	C	T	16: 45,392,301	R261H	probably benign	Het
Clk1	G	A	1: 58,421,102	S123L	probably benign	Het
Csrnp2	A	T	15: 100,484,690	D156E	probably damaging	Het
Ctss	C	T	3: 95,545,384	Q159*	probably null	Het
Dip2a	A	G	10: 76,321,493	S93P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ephb6	G	A	6: 41,616,809	R542Q	probably benign	Het
Fmo3	T	C	1: 162,954,311	D491G	possibly damaging	Het
Galnt14	A	T	17: 73,536,893	M140K	probably benign	Het
Ghsr	T	C	3: 27,371,837	V14A	probably benign	Het
Gm17546	C	A	15: 95,829,962		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hc	A	G	2: 35,019,670	V866A	probably benign	Het
Hoxb6	G	A	11: 96,299,522	G116R	probably damaging	Het
Hykk	A	G	9: 54,920,606	Y43C	probably damaging	Het
Jade2	T	C	11: 51,821,148	T495A	probably benign	Het
Kansl1	A	T	11: 104,342,972	V755E	possibly damaging	Het
Lrp2	T	A	2: 69,479,113	D2814V	probably damaging	Het
Mbd5	T	A	2: 49,256,997	N406K	probably damaging	Het
Mrgprx2	A	T	7: 48,482,836	V78D	probably damaging	Het
Mrpl20	A	G	4: 155,808,536	T112A	possibly damaging	Het
Nek11	T	A	9: 105,163,163	E566D	probably damaging	Het
Nostrin	T	C	2: 69,175,579	S235P	probably damaging	Het
Npas4	C	A	19: 4,986,777	S453I	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Psg18	A	T	7: 18,350,786	Y128*	probably null	Het
Ptges3l	A	T	11: 101,419,184		probably benign	Het
Pus1	T	C	5: 110,779,930		probably benign	Het
Raf1	T	A	6: 115,644,583	S12C	possibly damaging	Het
Rps6-ps2	T	G	8: 88,806,578		noncoding transcript	Het
Slc5a4b	A	G	10: 76,062,239	L547P	probably damaging	Het
Socs3	A	G	11: 117,967,828	S135P	probably benign	Het
St5	C	A	7: 109,556,836	E236*	probably null	Het
Stra6l	G	A	4: 45,873,682	V281M	possibly damaging	Het
Suco	G	A	1: 161,834,408	T818I	possibly damaging	Het
Syde1	A	T	10: 78,588,897	V367D	probably damaging	Het
Tet3	A	T	6: 83,376,883	L932*	probably null	Het
Trpm7	G	A	2: 126,813,185	L1278F	possibly damaging	Het
Vmn1r168	A	T	7: 23,541,065	T116S	probably damaging	Het
Wfdc6b	A	G	2: 164,617,294	Q92R	possibly damaging	Het

Other mutations in Met

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00533:Met	APN	6	17534937	unclassified	probably benign
IGL01066:Met	APN	6	17535105	critical splice donor site	probably null
IGL01344:Met	APN	6	17547032	missense	probably benign	0.44
IGL01413:Met	APN	6	17558896	splice site	probably benign
IGL01608:Met	APN	6	17558730	missense	probably damaging	1.00
IGL01613:Met	APN	6	17540577	missense	probably damaging	1.00
IGL01820:Met	APN	6	17534231	missense	possibly damaging	0.89
IGL01843:Met	APN	6	17491701	missense	probably damaging	1.00
IGL02014:Met	APN	6	17527257	splice site	probably benign
IGL02027:Met	APN	6	17563727	splice site	probably benign
IGL02243:Met	APN	6	17549094	missense	probably damaging	1.00
IGL02373:Met	APN	6	17491529	missense	probably damaging	1.00
IGL02616:Met	APN	6	17553347	missense	probably damaging	1.00
IGL02702:Met	APN	6	17534143	missense	possibly damaging	0.92
IGL02704:Met	APN	6	17491257	missense	possibly damaging	0.62
IGL02714:Met	APN	6	17491852	nonsense	probably null
IGL02936:Met	APN	6	17553397	missense	probably damaging	1.00
IGL02943:Met	APN	6	17535929	missense	possibly damaging	0.84
IGL03057:Met	APN	6	17558766	missense	probably damaging	1.00
IGL03124:Met	APN	6	17492078	missense	probably benign	0.27
IGL03171:Met	APN	6	17562273	splice site	probably benign
IGL03266:Met	APN	6	17540538	missense	possibly damaging	0.61
IGL03285:Met	APN	6	17553337	missense	probably damaging	0.98
R0453:Met	UTSW	6	17534198	missense	possibly damaging	0.88
R0543:Met	UTSW	6	17491970	missense	probably damaging	1.00
R0601:Met	UTSW	6	17555632	splice site	probably null
R0652:Met	UTSW	6	17491710	missense	probably benign	0.00
R0941:Met	UTSW	6	17491394	missense	probably damaging	1.00
R1142:Met	UTSW	6	17527183	nonsense	probably null
R1553:Met	UTSW	6	17491461	missense	probably benign	0.01
R1569:Met	UTSW	6	17531504	nonsense	probably null
R1744:Met	UTSW	6	17540646	missense	possibly damaging	0.47
R2224:Met	UTSW	6	17563722	splice site	probably null
R2308:Met	UTSW	6	17491742	missense	probably benign	0.00
R2369:Met	UTSW	6	17531528	missense	probably benign	0.04
R2393:Met	UTSW	6	17534198	missense	probably damaging	0.99
R2419:Met	UTSW	6	17535830	splice site	probably benign
R2483:Met	UTSW	6	17549086	missense	probably damaging	1.00
R2511:Met	UTSW	6	17491967	missense	probably damaging	1.00
R3622:Met	UTSW	6	17549086	missense	probably damaging	1.00
R3623:Met	UTSW	6	17549086	missense	probably damaging	1.00
R3624:Met	UTSW	6	17549086	missense	probably damaging	1.00
R4050:Met	UTSW	6	17533984	missense	probably benign
R4051:Met	UTSW	6	17548729	missense	possibly damaging	0.86
R4159:Met	UTSW	6	17562272	splice site	probably null
R4208:Met	UTSW	6	17548729	missense	possibly damaging	0.86
R4622:Met	UTSW	6	17513384	missense	probably benign	0.19
R4672:Met	UTSW	6	17571804	missense	probably benign	0.33
R4737:Met	UTSW	6	17491541	missense	probably damaging	1.00
R4738:Met	UTSW	6	17491541	missense	probably damaging	1.00
R4834:Met	UTSW	6	17491413	missense	probably damaging	0.97
R4855:Met	UTSW	6	17558797	missense	probably damaging	1.00
R4878:Met	UTSW	6	17549059	missense	probably damaging	1.00
R4902:Met	UTSW	6	17546996	missense	probably damaging	1.00
R5208:Met	UTSW	6	17526423	nonsense	probably null
R5355:Met	UTSW	6	17491362	missense	probably damaging	1.00
R5415:Met	UTSW	6	17527085	missense	probably benign	0.01
R5556:Met	UTSW	6	17534176	missense	probably benign	0.04
R5590:Met	UTSW	6	17548782	missense	probably benign	0.00
R5683:Met	UTSW	6	17571744	missense	probably damaging	1.00
R5872:Met	UTSW	6	17562198	missense	probably damaging	1.00
R5891:Met	UTSW	6	17491539	missense	probably benign	0.02
R5895:Met	UTSW	6	17531582	missense	probably benign	0.02
R6063:Met	UTSW	6	17491968	missense	probably damaging	1.00
R6262:Met	UTSW	6	17553404	missense	probably benign	0.00
R6362:Met	UTSW	6	17558733	missense	probably damaging	1.00
R6747:Met	UTSW	6	17571467	missense	probably damaging	1.00
R6966:Met	UTSW	6	17531532	missense	possibly damaging	0.65
R6989:Met	UTSW	6	17535928	missense	possibly damaging	0.67
R6989:Met	UTSW	6	17535929	missense	probably damaging	1.00
R7017:Met	UTSW	6	17491287	nonsense	probably null
R7037:Met	UTSW	6	17547128	intron	probably benign
R7141:Met	UTSW	6	17527155	missense	probably benign	0.01
R7242:Met	UTSW	6	17491317	missense	probably damaging	1.00
R7282:Met	UTSW	6	17547012	nonsense	probably null
R7624:Met	UTSW	6	17558835	missense	probably damaging	1.00
R7770:Met	UTSW	6	17491407	missense	possibly damaging	0.79
R7797:Met	UTSW	6	17533953	missense	probably damaging	1.00
R8082:Met	UTSW	6	17492313	missense	probably damaging	0.98
R8109:Met	UTSW	6	17562237	missense	probably damaging	1.00
R8162:Met	UTSW	6	17547062	missense	probably damaging	0.98
R8315:Met	UTSW	6	17533957	missense	probably damaging	0.99
R8325:Met	UTSW	6	17571672	missense	probably damaging	1.00
R8348:Met	UTSW	6	17571800	missense	probably benign	0.00
R8354:Met	UTSW	6	17491769	missense	probably damaging	1.00
R8448:Met	UTSW	6	17571800	missense	probably benign	0.00
R8454:Met	UTSW	6	17491769	missense	probably damaging	1.00
R8465:Met	UTSW	6	17571810	missense	probably benign	0.04
R8479:Met	UTSW	6	17491747	splice site	probably null
R8737:Met	UTSW	6	17540511	missense	probably benign	0.00
R8903:Met	UTSW	6	17549138	missense	probably benign	0.19
R8964:Met	UTSW	6	17527145	missense	probably damaging	1.00
R8998:Met	UTSW	6	17491535	missense	probably benign	0.43
R9088:Met	UTSW	6	17548716	nonsense	probably null
R9369:Met	UTSW	6	17492229	missense	probably benign
R9394:Met	UTSW	6	17513396	missense	probably damaging	1.00
R9530:Met	UTSW	6	17558832	missense	probably damaging	1.00
R9564:Met	UTSW	6	17531426	missense	probably benign
R9759:Met	UTSW	6	17555562	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAGGTCCACTGCATGTTCTC -3'
(R):5'- GAGTGCAACCCAGAGTCTAC -3'

Sequencing Primer
(F):5'- ATGTTCTCCCCAGAAGAGGAGTC -3'
(R):5'- GTCTACGGAACAGAACCTGATTATTC -3'

Posted On

2016-03-01