Mutagenetix > Incidental Mutation

Incidental Mutation 'R4846:Tet3'

372160

Institutional Source

Beutler Lab

Gene Symbol

Tet3

Ensembl Gene

ENSMUSG00000034832

Gene Name

tet methylcytosine dioxygenase 3

Synonyms

D230004J03Rik, B430006D22Rik

MMRRC Submission

042459-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.643) question?

Stock #

R4846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83362373-83459084 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 83376883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 932 (L932*)

Ref Sequence

ENSEMBL: ENSMUSP00000139630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548]

AlphaFold

Q8BG87

Predicted Effect

probably null
Transcript: ENSMUST00000089622
AA Change: L797*

SMART Domains

Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: L797*

Domain	Start	End	E-Value	Type
low complexity region	27	38	N/A	INTRINSIC
low complexity region	66	77	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
internal_repeat_1	160	277	4.9e-5	PROSPERO
low complexity region	279	297	N/A	INTRINSIC
low complexity region	359	371	N/A	INTRINSIC
low complexity region	418	456	N/A	INTRINSIC
Tet_JBP	858	1570	N/A	SMART
coiled coil region	1579	1603	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000186548
AA Change: L932*

SMART Domains

Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: L932*

Domain	Start	End	E-Value	Type
Pfam:zf-CXXC	49	89	8e-6	PFAM
low complexity region	162	173	N/A	INTRINSIC
low complexity region	201	212	N/A	INTRINSIC
low complexity region	250	261	N/A	INTRINSIC
internal_repeat_1	295	412	5.5e-5	PROSPERO
low complexity region	414	432	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
low complexity region	553	591	N/A	INTRINSIC
Tet_JBP	993	1705	N/A	SMART
coiled coil region	1714	1738	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,233	D591G	probably benign	Het
9930012K11Rik	T	A	14: 70,155,943	H299L	probably damaging	Het
Abcb4	C	T	5: 8,935,180	A687V	probably benign	Het
Adam20	A	G	8: 40,795,011	T53A	probably benign	Het
Afg1l	G	A	10: 42,454,494	T59I	probably benign	Het
AI837181	A	G	19: 5,426,301	Q164R	probably benign	Het
Anapc15	T	A	7: 101,897,767	I12N	probably benign	Het
Ankrd55	A	C	13: 112,363,454	E278D	probably benign	Het
Axin2	A	G	11: 108,942,299	T437A	probably benign	Het
BC051665	T	C	13: 60,784,081	D168G	probably damaging	Het
Btbd11	A	G	10: 85,629,266	T657A	probably damaging	Het
Cd200	C	T	16: 45,392,301	R261H	probably benign	Het
Clk1	G	A	1: 58,421,102	S123L	probably benign	Het
Csrnp2	A	T	15: 100,484,690	D156E	probably damaging	Het
Ctss	C	T	3: 95,545,384	Q159*	probably null	Het
Dip2a	A	G	10: 76,321,493	S93P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ephb6	G	A	6: 41,616,809	R542Q	probably benign	Het
Fmo3	T	C	1: 162,954,311	D491G	possibly damaging	Het
Galnt14	A	T	17: 73,536,893	M140K	probably benign	Het
Ghsr	T	C	3: 27,371,837	V14A	probably benign	Het
Gm17546	C	A	15: 95,829,962		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hc	A	G	2: 35,019,670	V866A	probably benign	Het
Hoxb6	G	A	11: 96,299,522	G116R	probably damaging	Het
Hykk	A	G	9: 54,920,606	Y43C	probably damaging	Het
Jade2	T	C	11: 51,821,148	T495A	probably benign	Het
Kansl1	A	T	11: 104,342,972	V755E	possibly damaging	Het
Lrp2	T	A	2: 69,479,113	D2814V	probably damaging	Het
Mbd5	T	A	2: 49,256,997	N406K	probably damaging	Het
Met	A	T	6: 17,491,929	D230V	probably damaging	Het
Mrgprx2	A	T	7: 48,482,836	V78D	probably damaging	Het
Mrpl20	A	G	4: 155,808,536	T112A	possibly damaging	Het
Nek11	T	A	9: 105,163,163	E566D	probably damaging	Het
Nostrin	T	C	2: 69,175,579	S235P	probably damaging	Het
Npas4	C	A	19: 4,986,777	S453I	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Psg18	A	T	7: 18,350,786	Y128*	probably null	Het
Ptges3l	A	T	11: 101,419,184		probably benign	Het
Pus1	T	C	5: 110,779,930		probably benign	Het
Raf1	T	A	6: 115,644,583	S12C	possibly damaging	Het
Rps6-ps2	T	G	8: 88,806,578		noncoding transcript	Het
Slc5a4b	A	G	10: 76,062,239	L547P	probably damaging	Het
Socs3	A	G	11: 117,967,828	S135P	probably benign	Het
St5	C	A	7: 109,556,836	E236*	probably null	Het
Stra6l	G	A	4: 45,873,682	V281M	possibly damaging	Het
Suco	G	A	1: 161,834,408	T818I	possibly damaging	Het
Syde1	A	T	10: 78,588,897	V367D	probably damaging	Het
Trpm7	G	A	2: 126,813,185	L1278F	possibly damaging	Het
Vmn1r168	A	T	7: 23,541,065	T116S	probably damaging	Het
Wfdc6b	A	G	2: 164,617,294	Q92R	possibly damaging	Het

Other mutations in Tet3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Tet3	APN	6	83368655	missense	probably benign	0.06
IGL01396:Tet3	APN	6	83369638	nonsense	probably null
IGL02344:Tet3	APN	6	83403833	missense	probably benign	0.04
IGL02987:Tet3	APN	6	83368092	missense	probably damaging	0.99
IGL03126:Tet3	APN	6	83376787	missense	probably damaging	1.00
IGL03155:Tet3	APN	6	83368383	missense	probably damaging	1.00
IGL03286:Tet3	APN	6	83375778	missense	probably damaging	1.00
Reedy	UTSW	6	83368084	nonsense	probably null
P0033:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R0131:Tet3	UTSW	6	83368788	missense	probably damaging	1.00
R0295:Tet3	UTSW	6	83369139	missense	probably benign	0.14
R0504:Tet3	UTSW	6	83373794	missense	probably damaging	1.00
R0524:Tet3	UTSW	6	83379942	missense	probably damaging	1.00
R1061:Tet3	UTSW	6	83373323	missense	probably damaging	0.99
R1160:Tet3	UTSW	6	83404452	missense	probably benign	0.00
R1550:Tet3	UTSW	6	83386028	missense	probably damaging	0.97
R1640:Tet3	UTSW	6	83369315	missense	probably benign	0.44
R1658:Tet3	UTSW	6	83369057	missense	probably benign	0.44
R1746:Tet3	UTSW	6	83368068	missense	probably damaging	1.00
R1761:Tet3	UTSW	6	83403659	missense	probably damaging	0.99
R1832:Tet3	UTSW	6	83403645	missense	probably benign
R1835:Tet3	UTSW	6	83404163	missense	possibly damaging	0.95
R1932:Tet3	UTSW	6	83404379	missense	possibly damaging	0.94
R2014:Tet3	UTSW	6	83386075	missense	probably damaging	1.00
R2230:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2232:Tet3	UTSW	6	83369471	missense	probably damaging	1.00
R2922:Tet3	UTSW	6	83368512	missense	probably damaging	1.00
R3429:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R3430:Tet3	UTSW	6	83403419	missense	probably damaging	1.00
R4291:Tet3	UTSW	6	83373199	missense	probably damaging	1.00
R4349:Tet3	UTSW	6	83403275	missense	probably benign
R4809:Tet3	UTSW	6	83402946	missense	probably benign
R5039:Tet3	UTSW	6	83375896	missense	probably damaging	1.00
R5233:Tet3	UTSW	6	83386063	missense	probably damaging	1.00
R5363:Tet3	UTSW	6	83376764	critical splice donor site	probably null
R5880:Tet3	UTSW	6	83370550	missense	probably damaging	1.00
R6270:Tet3	UTSW	6	83375791	missense	possibly damaging	0.86
R6277:Tet3	UTSW	6	83368084	nonsense	probably null
R6564:Tet3	UTSW	6	83386070	missense	possibly damaging	0.92
R6622:Tet3	UTSW	6	83403444	missense	probably benign	0.00
R7089:Tet3	UTSW	6	83455024	missense	possibly damaging	0.46
R7244:Tet3	UTSW	6	83370621	missense	probably damaging	1.00
R7251:Tet3	UTSW	6	83404056	missense	probably benign
R7361:Tet3	UTSW	6	83368094	missense	probably benign	0.15
R7436:Tet3	UTSW	6	83368229	small insertion	probably benign
R7438:Tet3	UTSW	6	83368229	small insertion	probably benign
R7544:Tet3	UTSW	6	83404641	missense	probably damaging	1.00
R7552:Tet3	UTSW	6	83368307	missense	probably damaging	1.00
R7942:Tet3	UTSW	6	83376974	missense	probably damaging	1.00
R8010:Tet3	UTSW	6	83403246	missense	unknown
R8063:Tet3	UTSW	6	83402741	missense	probably damaging	1.00
R8307:Tet3	UTSW	6	83379927	missense	probably damaging	1.00
R9016:Tet3	UTSW	6	83368271	missense	probably damaging	1.00
R9020:Tet3	UTSW	6	83404436	missense	probably damaging	1.00
R9377:Tet3	UTSW	6	83403614	missense	possibly damaging	0.95
R9476:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9476:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9510:Tet3	UTSW	6	83403953	missense	possibly damaging	0.91
R9510:Tet3	UTSW	6	83404826	critical splice acceptor site	probably null
R9582:Tet3	UTSW	6	83404244	missense	probably damaging	0.99
R9671:Tet3	UTSW	6	83404154	missense	possibly damaging	0.89
R9801:Tet3	UTSW	6	83369454	missense	possibly damaging	0.94
X0004:Tet3	UTSW	6	83403423	missense	probably benign	0.17
Z1176:Tet3	UTSW	6	83370698	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83404350	missense	probably damaging	1.00
Z1176:Tet3	UTSW	6	83459021	missense	unknown
Z1177:Tet3	UTSW	6	83404294	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CAGTAAAGTTGAGCCAGGGC -3'
(R):5'- CAGCTACAGGTCTGTGGGATAG -3'

Sequencing Primer
(F):5'- AGCATCCCAGTGCCTGCTAC -3'
(R):5'- TAGTGAGGGGCATGTACCATG -3'

Posted On

2016-03-01