Incidental Mutation 'R4846:Psg18'
ID 372163
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 18350786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 128 (Y128*)
Ref Sequence ENSEMBL: ENSMUSP00000096380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably null
Transcript: ENSMUST00000003597
AA Change: Y249*
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: Y249*

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098783
AA Change: Y128*
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505
AA Change: Y128*

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183222
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3053:Psg18 UTSW 7 18349193 missense probably damaging 1.00
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAGTCTGACCCATGGACATTTC -3'
(R):5'- CGCTTTTCTGGTACAAAGGG -3'

Sequencing Primer
(F):5'- CCTACATGTGTGTCCTGCATAGAG -3'
(R):5'- CTGGTACAAAGGGCTGATTGC -3'
Posted On 2016-03-01