Incidental Mutation 'R4846:Nek11'
ID372172
Institutional Source Beutler Lab
Gene Symbol Nek11
Ensembl Gene ENSMUSG00000035032
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 11
Synonyms4932416N14Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105162156-105395524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105163163 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 566 (E566D)
Ref Sequence ENSEMBL: ENSMUSP00000038611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038648] [ENSMUST00000177029]
Predicted Effect probably damaging
Transcript: ENSMUST00000038648
AA Change: E566D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032
AA Change: E566D

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
coiled coil region 348 384 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177029
SMART Domains Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
SCOP:d1h8fa_ 11 80 1e-6 SMART
Blast:S_TKc 30 70 1e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192953
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the never in mitosis gene A family of kinases. The encoded protein localizes to the nucleoli, and may function with NEK2A in the S-phase checkpoint. The encoded protein appears to play roles in DNA replication and response to genotoxic stress. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Nek11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Nek11 APN 9 105392913 missense probably damaging 1.00
IGL01369:Nek11 APN 9 105300060 critical splice donor site probably null
IGL01958:Nek11 APN 9 105300303 missense probably benign 0.06
IGL03099:Nek11 APN 9 105287653 missense probably benign 0.02
IGL03256:Nek11 APN 9 105244414 missense probably damaging 1.00
IGL03400:Nek11 APN 9 105204866 missense probably benign 0.01
R0051:Nek11 UTSW 9 105218539 splice site probably benign
R0051:Nek11 UTSW 9 105218539 splice site probably benign
R0194:Nek11 UTSW 9 105392952 missense probably benign 0.05
R0942:Nek11 UTSW 9 105295371 unclassified probably null
R1226:Nek11 UTSW 9 105392892 missense probably damaging 1.00
R1503:Nek11 UTSW 9 105163204 missense probably damaging 1.00
R1709:Nek11 UTSW 9 105348061 missense probably damaging 1.00
R1958:Nek11 UTSW 9 105293717 missense probably benign 0.00
R2128:Nek11 UTSW 9 105300361 missense probably benign 0.01
R3754:Nek11 UTSW 9 105314718 missense probably damaging 1.00
R4027:Nek11 UTSW 9 105244390 nonsense probably null
R4594:Nek11 UTSW 9 105392847 critical splice donor site probably null
R4650:Nek11 UTSW 9 105348080 missense possibly damaging 0.79
R4724:Nek11 UTSW 9 105392970 missense possibly damaging 0.89
R4903:Nek11 UTSW 9 105314722 missense possibly damaging 0.63
R4908:Nek11 UTSW 9 105298289 missense probably benign 0.00
R4912:Nek11 UTSW 9 105287658 missense probably benign 0.01
R4930:Nek11 UTSW 9 105300066 missense probably damaging 1.00
R5827:Nek11 UTSW 9 105314745 missense probably damaging 1.00
R5860:Nek11 UTSW 9 105392961 missense probably benign 0.01
R6030:Nek11 UTSW 9 105204888 critical splice acceptor site probably null
R6030:Nek11 UTSW 9 105204888 critical splice acceptor site probably null
R6154:Nek11 UTSW 9 105323169 makesense probably null
R6915:Nek11 UTSW 9 105393057 unclassified probably benign
R7197:Nek11 UTSW 9 105244415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGAGTGCCCTTGACCGG -3'
(R):5'- GGGTGAGATTCTGCACCTTAG -3'

Sequencing Primer
(F):5'- TGACCGGCTTCTTCTGGGC -3'
(R):5'- GAGATTCTGCACCTTAGGGTCATC -3'
Posted On2016-03-01