Mutagenetix > Incidental Mutation

Incidental Mutation 'R4846:Slc5a4b'

372174

Institutional Source

Beutler Lab

Gene Symbol

Slc5a4b

Ensembl Gene

ENSMUSG00000020226

Gene Name

solute carrier family 5 (neutral amino acid transporters, system A), member 4b

Synonyms

pSGLT2, SGLT3b, 2010104G07Rik, SAAT1

MMRRC Submission

042459-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R4846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76057494-76110961 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76062239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 547 (L547P)

Ref Sequence

ENSEMBL: ENSMUSP00000113582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120757]

AlphaFold

Q91ZP4

Predicted Effect

probably damaging
Transcript: ENSMUST00000120757
AA Change: L547P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: L547P

Domain	Start	End	E-Value	Type
low complexity region	16	21	N/A	INTRINSIC
Pfam:SSF	58	492	1.4e-163	PFAM
transmembrane domain	526	548	N/A	INTRINSIC
transmembrane domain	640	659	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,233	D591G	probably benign	Het
9930012K11Rik	T	A	14: 70,155,943	H299L	probably damaging	Het
Abcb4	C	T	5: 8,935,180	A687V	probably benign	Het
Adam20	A	G	8: 40,795,011	T53A	probably benign	Het
Afg1l	G	A	10: 42,454,494	T59I	probably benign	Het
AI837181	A	G	19: 5,426,301	Q164R	probably benign	Het
Anapc15	T	A	7: 101,897,767	I12N	probably benign	Het
Ankrd55	A	C	13: 112,363,454	E278D	probably benign	Het
Axin2	A	G	11: 108,942,299	T437A	probably benign	Het
BC051665	T	C	13: 60,784,081	D168G	probably damaging	Het
Btbd11	A	G	10: 85,629,266	T657A	probably damaging	Het
Cd200	C	T	16: 45,392,301	R261H	probably benign	Het
Clk1	G	A	1: 58,421,102	S123L	probably benign	Het
Csrnp2	A	T	15: 100,484,690	D156E	probably damaging	Het
Ctss	C	T	3: 95,545,384	Q159*	probably null	Het
Dip2a	A	G	10: 76,321,493	S93P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ephb6	G	A	6: 41,616,809	R542Q	probably benign	Het
Fmo3	T	C	1: 162,954,311	D491G	possibly damaging	Het
Galnt14	A	T	17: 73,536,893	M140K	probably benign	Het
Ghsr	T	C	3: 27,371,837	V14A	probably benign	Het
Gm17546	C	A	15: 95,829,962		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hc	A	G	2: 35,019,670	V866A	probably benign	Het
Hoxb6	G	A	11: 96,299,522	G116R	probably damaging	Het
Hykk	A	G	9: 54,920,606	Y43C	probably damaging	Het
Jade2	T	C	11: 51,821,148	T495A	probably benign	Het
Kansl1	A	T	11: 104,342,972	V755E	possibly damaging	Het
Lrp2	T	A	2: 69,479,113	D2814V	probably damaging	Het
Mbd5	T	A	2: 49,256,997	N406K	probably damaging	Het
Met	A	T	6: 17,491,929	D230V	probably damaging	Het
Mrgprx2	A	T	7: 48,482,836	V78D	probably damaging	Het
Mrpl20	A	G	4: 155,808,536	T112A	possibly damaging	Het
Nek11	T	A	9: 105,163,163	E566D	probably damaging	Het
Nostrin	T	C	2: 69,175,579	S235P	probably damaging	Het
Npas4	C	A	19: 4,986,777	S453I	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Psg18	A	T	7: 18,350,786	Y128*	probably null	Het
Ptges3l	A	T	11: 101,419,184		probably benign	Het
Pus1	T	C	5: 110,779,930		probably benign	Het
Raf1	T	A	6: 115,644,583	S12C	possibly damaging	Het
Rps6-ps2	T	G	8: 88,806,578		noncoding transcript	Het
Socs3	A	G	11: 117,967,828	S135P	probably benign	Het
St5	C	A	7: 109,556,836	E236*	probably null	Het
Stra6l	G	A	4: 45,873,682	V281M	possibly damaging	Het
Suco	G	A	1: 161,834,408	T818I	possibly damaging	Het
Syde1	A	T	10: 78,588,897	V367D	probably damaging	Het
Tet3	A	T	6: 83,376,883	L932*	probably null	Het
Trpm7	G	A	2: 126,813,185	L1278F	possibly damaging	Het
Vmn1r168	A	T	7: 23,541,065	T116S	probably damaging	Het
Wfdc6b	A	G	2: 164,617,294	Q92R	possibly damaging	Het

Other mutations in Slc5a4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01348:Slc5a4b	APN	10	76070588	missense	probably damaging	1.00
IGL01433:Slc5a4b	APN	10	76070495	splice site	probably benign
IGL01754:Slc5a4b	APN	10	76070615	missense	probably damaging	1.00
IGL01904:Slc5a4b	APN	10	76060426	missense	probably damaging	0.98
IGL01990:Slc5a4b	APN	10	76060354	missense	probably benign	0.01
IGL02211:Slc5a4b	APN	10	76060463	splice site	probably benign
IGL02254:Slc5a4b	APN	10	76060430	missense	probably benign
IGL02389:Slc5a4b	APN	10	76072465	nonsense	probably null
IGL02427:Slc5a4b	APN	10	76058879	missense	possibly damaging	0.47
IGL02493:Slc5a4b	APN	10	76075015	missense	probably damaging	1.00
IGL02554:Slc5a4b	APN	10	76110851	missense	possibly damaging	0.75
IGL02670:Slc5a4b	APN	10	76075100	missense	probably damaging	1.00
R0254:Slc5a4b	UTSW	10	76070628	missense	possibly damaging	0.55
R0285:Slc5a4b	UTSW	10	76062283	missense	probably damaging	0.99
R0294:Slc5a4b	UTSW	10	76081327	missense	probably damaging	1.00
R0522:Slc5a4b	UTSW	10	76090700	missense	probably damaging	0.99
R0601:Slc5a4b	UTSW	10	76064036	missense	possibly damaging	0.81
R0714:Slc5a4b	UTSW	10	76081507	missense	probably benign	0.09
R0975:Slc5a4b	UTSW	10	76081407	missense	probably benign	0.09
R1934:Slc5a4b	UTSW	10	76081473	missense	possibly damaging	0.51
R2339:Slc5a4b	UTSW	10	76108549	missense	probably damaging	1.00
R2886:Slc5a4b	UTSW	10	76075073	missense	probably damaging	0.98
R3552:Slc5a4b	UTSW	10	76081524	missense	probably damaging	0.99
R3890:Slc5a4b	UTSW	10	76062260	missense	probably benign	0.01
R4012:Slc5a4b	UTSW	10	76074992	missense	probably damaging	1.00
R4259:Slc5a4b	UTSW	10	76103852	missense	probably damaging	1.00
R4260:Slc5a4b	UTSW	10	76103852	missense	probably damaging	1.00
R4471:Slc5a4b	UTSW	10	76058891	nonsense	probably null
R4667:Slc5a4b	UTSW	10	76075045	missense	possibly damaging	0.78
R4939:Slc5a4b	UTSW	10	76081467	missense	probably benign	0.44
R5181:Slc5a4b	UTSW	10	76060387	nonsense	probably null
R5319:Slc5a4b	UTSW	10	76062399	missense	probably benign	0.08
R6306:Slc5a4b	UTSW	10	76081351	missense	probably benign	0.01
R6422:Slc5a4b	UTSW	10	76103862	missense	probably damaging	0.97
R6837:Slc5a4b	UTSW	10	76062386	missense	possibly damaging	0.49
R6997:Slc5a4b	UTSW	10	76089978	missense	probably damaging	0.97
R7140:Slc5a4b	UTSW	10	76075109	missense	probably damaging	1.00
R7527:Slc5a4b	UTSW	10	76110908	missense	probably benign	0.01
R7683:Slc5a4b	UTSW	10	76064072	missense	probably damaging	0.96
R7718:Slc5a4b	UTSW	10	76070573	missense	probably damaging	1.00
R7794:Slc5a4b	UTSW	10	76062299	missense	probably benign	0.19
R7877:Slc5a4b	UTSW	10	76075052	missense	probably damaging	1.00
R8150:Slc5a4b	UTSW	10	76103846	missense	possibly damaging	0.93
R8843:Slc5a4b	UTSW	10	76075091	missense	probably damaging	1.00
R9111:Slc5a4b	UTSW	10	76089993	splice site	probably benign
R9163:Slc5a4b	UTSW	10	76081331	nonsense	probably null
R9195:Slc5a4b	UTSW	10	76062315	missense	probably damaging	1.00
R9600:Slc5a4b	UTSW	10	76060405	missense	probably damaging	1.00
R9643:Slc5a4b	UTSW	10	76110062	missense	probably benign	0.01
R9656:Slc5a4b	UTSW	10	76108557	missense	probably damaging	0.98
R9699:Slc5a4b	UTSW	10	76110840	missense	probably damaging	0.99
X0019:Slc5a4b	UTSW	10	76110851	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- ATCCTGAAATGGCGGTGGTG -3'
(R):5'- CAGCAAGCAGGATGGTAACC -3'

Sequencing Primer
(F):5'- CCCCAGCCTTATTAGAGAGATTGTG -3'
(R):5'- AGCATTCTGGGGGCTAATG -3'

Posted On

2016-03-01