Incidental Mutation 'R4846:Slc5a4b'
ID 372174
Institutional Source Beutler Lab
Gene Symbol Slc5a4b
Ensembl Gene ENSMUSG00000020226
Gene Name solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms SGLT3b, pSGLT2, 2010104G07Rik, SAAT1
MMRRC Submission 042459-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R4846 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 75894452-75946852 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75898073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 547 (L547P)
Ref Sequence ENSEMBL: ENSMUSP00000113582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120757]
AlphaFold Q91ZP4
Predicted Effect probably damaging
Transcript: ENSMUST00000120757
AA Change: L547P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113582
Gene: ENSMUSG00000020226
AA Change: L547P

DomainStartEndE-ValueType
low complexity region 16 21 N/A INTRINSIC
Pfam:SSF 58 492 1.4e-163 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 640 659 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T A 14: 70,393,392 (GRCm39) H299L probably damaging Het
Abcb4 C T 5: 8,985,180 (GRCm39) A687V probably benign Het
Abtb3 A G 10: 85,465,130 (GRCm39) T657A probably damaging Het
Adam20 A G 8: 41,248,048 (GRCm39) T53A probably benign Het
Afg1l G A 10: 42,330,490 (GRCm39) T59I probably benign Het
AI837181 A G 19: 5,476,329 (GRCm39) Q164R probably benign Het
Anapc15 T A 7: 101,546,974 (GRCm39) I12N probably benign Het
Ankrd55 A C 13: 112,499,988 (GRCm39) E278D probably benign Het
Axin2 A G 11: 108,833,125 (GRCm39) T437A probably benign Het
BC051665 T C 13: 60,931,895 (GRCm39) D168G probably damaging Het
Cd200 C T 16: 45,212,664 (GRCm39) R261H probably benign Het
Clk1 G A 1: 58,460,261 (GRCm39) S123L probably benign Het
Csrnp2 A T 15: 100,382,571 (GRCm39) D156E probably damaging Het
Ctss C T 3: 95,452,695 (GRCm39) Q159* probably null Het
Dennd2b C A 7: 109,156,043 (GRCm39) E236* probably null Het
Dip2a A G 10: 76,157,327 (GRCm39) S93P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Ephb6 G A 6: 41,593,743 (GRCm39) R542Q probably benign Het
Fmo3 T C 1: 162,781,880 (GRCm39) D491G possibly damaging Het
Galnt14 A T 17: 73,843,888 (GRCm39) M140K probably benign Het
Ghsr T C 3: 27,425,986 (GRCm39) V14A probably benign Het
Gm17546 C A 15: 95,727,843 (GRCm39) probably benign Het
Gprc5c G T 11: 114,755,093 (GRCm39) V257L possibly damaging Het
Hc A G 2: 34,909,682 (GRCm39) V866A probably benign Het
Hoxb6 G A 11: 96,190,348 (GRCm39) G116R probably damaging Het
Hykk A G 9: 54,827,890 (GRCm39) Y43C probably damaging Het
Jade2 T C 11: 51,711,975 (GRCm39) T495A probably benign Het
Kansl1 A T 11: 104,233,798 (GRCm39) V755E possibly damaging Het
Lrp2 T A 2: 69,309,457 (GRCm39) D2814V probably damaging Het
Mbd5 T A 2: 49,147,009 (GRCm39) N406K probably damaging Het
Met A T 6: 17,491,928 (GRCm39) D230V probably damaging Het
Mrgprx2 A T 7: 48,132,584 (GRCm39) V78D probably damaging Het
Mrpl20 A G 4: 155,892,993 (GRCm39) T112A possibly damaging Het
Nek11 T A 9: 105,040,362 (GRCm39) E566D probably damaging Het
Nostrin T C 2: 69,005,923 (GRCm39) S235P probably damaging Het
Npas4 C A 19: 5,036,805 (GRCm39) S453I probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Psg18 A T 7: 18,084,711 (GRCm39) Y128* probably null Het
Ptges3l A T 11: 101,310,010 (GRCm39) probably benign Het
Pus1 T C 5: 110,927,796 (GRCm39) probably benign Het
Raf1 T A 6: 115,621,544 (GRCm39) S12C possibly damaging Het
Rps6-ps2 T G 8: 89,533,206 (GRCm39) noncoding transcript Het
Socs3 A G 11: 117,858,654 (GRCm39) S135P probably benign Het
Spata31d1e T C 13: 59,890,047 (GRCm39) D591G probably benign Het
Stra6l G A 4: 45,873,682 (GRCm39) V281M possibly damaging Het
Suco G A 1: 161,661,977 (GRCm39) T818I possibly damaging Het
Syde1 A T 10: 78,424,731 (GRCm39) V367D probably damaging Het
Tet3 A T 6: 83,353,865 (GRCm39) L932* probably null Het
Trpm7 G A 2: 126,655,105 (GRCm39) L1278F possibly damaging Het
Vmn1r168 A T 7: 23,240,490 (GRCm39) T116S probably damaging Het
Wfdc6b A G 2: 164,459,214 (GRCm39) Q92R possibly damaging Het
Other mutations in Slc5a4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Slc5a4b APN 10 75,906,422 (GRCm39) missense probably damaging 1.00
IGL01433:Slc5a4b APN 10 75,906,329 (GRCm39) splice site probably benign
IGL01754:Slc5a4b APN 10 75,906,449 (GRCm39) missense probably damaging 1.00
IGL01904:Slc5a4b APN 10 75,896,260 (GRCm39) missense probably damaging 0.98
IGL01990:Slc5a4b APN 10 75,896,188 (GRCm39) missense probably benign 0.01
IGL02211:Slc5a4b APN 10 75,896,297 (GRCm39) splice site probably benign
IGL02254:Slc5a4b APN 10 75,896,264 (GRCm39) missense probably benign
IGL02389:Slc5a4b APN 10 75,908,299 (GRCm39) nonsense probably null
IGL02427:Slc5a4b APN 10 75,894,713 (GRCm39) missense possibly damaging 0.47
IGL02493:Slc5a4b APN 10 75,910,849 (GRCm39) missense probably damaging 1.00
IGL02554:Slc5a4b APN 10 75,946,685 (GRCm39) missense possibly damaging 0.75
IGL02670:Slc5a4b APN 10 75,910,934 (GRCm39) missense probably damaging 1.00
R0254:Slc5a4b UTSW 10 75,906,462 (GRCm39) missense possibly damaging 0.55
R0285:Slc5a4b UTSW 10 75,898,117 (GRCm39) missense probably damaging 0.99
R0294:Slc5a4b UTSW 10 75,917,161 (GRCm39) missense probably damaging 1.00
R0522:Slc5a4b UTSW 10 75,926,534 (GRCm39) missense probably damaging 0.99
R0601:Slc5a4b UTSW 10 75,899,870 (GRCm39) missense possibly damaging 0.81
R0714:Slc5a4b UTSW 10 75,917,341 (GRCm39) missense probably benign 0.09
R0975:Slc5a4b UTSW 10 75,917,241 (GRCm39) missense probably benign 0.09
R1934:Slc5a4b UTSW 10 75,917,307 (GRCm39) missense possibly damaging 0.51
R2339:Slc5a4b UTSW 10 75,944,383 (GRCm39) missense probably damaging 1.00
R2886:Slc5a4b UTSW 10 75,910,907 (GRCm39) missense probably damaging 0.98
R3552:Slc5a4b UTSW 10 75,917,358 (GRCm39) missense probably damaging 0.99
R3890:Slc5a4b UTSW 10 75,898,094 (GRCm39) missense probably benign 0.01
R4012:Slc5a4b UTSW 10 75,910,826 (GRCm39) missense probably damaging 1.00
R4259:Slc5a4b UTSW 10 75,939,686 (GRCm39) missense probably damaging 1.00
R4260:Slc5a4b UTSW 10 75,939,686 (GRCm39) missense probably damaging 1.00
R4471:Slc5a4b UTSW 10 75,894,725 (GRCm39) nonsense probably null
R4667:Slc5a4b UTSW 10 75,910,879 (GRCm39) missense possibly damaging 0.78
R4939:Slc5a4b UTSW 10 75,917,301 (GRCm39) missense probably benign 0.44
R5181:Slc5a4b UTSW 10 75,896,221 (GRCm39) nonsense probably null
R5319:Slc5a4b UTSW 10 75,898,233 (GRCm39) missense probably benign 0.08
R6306:Slc5a4b UTSW 10 75,917,185 (GRCm39) missense probably benign 0.01
R6422:Slc5a4b UTSW 10 75,939,696 (GRCm39) missense probably damaging 0.97
R6837:Slc5a4b UTSW 10 75,898,220 (GRCm39) missense possibly damaging 0.49
R6997:Slc5a4b UTSW 10 75,925,812 (GRCm39) missense probably damaging 0.97
R7140:Slc5a4b UTSW 10 75,910,943 (GRCm39) missense probably damaging 1.00
R7527:Slc5a4b UTSW 10 75,946,742 (GRCm39) missense probably benign 0.01
R7683:Slc5a4b UTSW 10 75,899,906 (GRCm39) missense probably damaging 0.96
R7718:Slc5a4b UTSW 10 75,906,407 (GRCm39) missense probably damaging 1.00
R7794:Slc5a4b UTSW 10 75,898,133 (GRCm39) missense probably benign 0.19
R7877:Slc5a4b UTSW 10 75,910,886 (GRCm39) missense probably damaging 1.00
R8150:Slc5a4b UTSW 10 75,939,680 (GRCm39) missense possibly damaging 0.93
R8843:Slc5a4b UTSW 10 75,910,925 (GRCm39) missense probably damaging 1.00
R9111:Slc5a4b UTSW 10 75,925,827 (GRCm39) splice site probably benign
R9163:Slc5a4b UTSW 10 75,917,165 (GRCm39) nonsense probably null
R9195:Slc5a4b UTSW 10 75,898,149 (GRCm39) missense probably damaging 1.00
R9600:Slc5a4b UTSW 10 75,896,239 (GRCm39) missense probably damaging 1.00
R9643:Slc5a4b UTSW 10 75,945,896 (GRCm39) missense probably benign 0.01
R9656:Slc5a4b UTSW 10 75,944,391 (GRCm39) missense probably damaging 0.98
R9699:Slc5a4b UTSW 10 75,946,674 (GRCm39) missense probably damaging 0.99
X0019:Slc5a4b UTSW 10 75,946,685 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ATCCTGAAATGGCGGTGGTG -3'
(R):5'- CAGCAAGCAGGATGGTAACC -3'

Sequencing Primer
(F):5'- CCCCAGCCTTATTAGAGAGATTGTG -3'
(R):5'- AGCATTCTGGGGGCTAATG -3'
Posted On 2016-03-01