Mutagenetix > Incidental Mutation

Incidental Mutation 'R4846:Dip2a'

372175

Institutional Source

Beutler Lab

Gene Symbol

Dip2a

Ensembl Gene

ENSMUSG00000020231

Gene Name

disco interacting protein 2 homolog A

Synonyms

Kiaa0184-hp, 4931420H10Rik, Dip2

MMRRC Submission

042459-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4846 (G1)

Quality Score

178

Status

Validated

Chromosome

Chromosomal Location

76259429-76345291 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76321493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 93 (S93P)

Ref Sequence

ENSEMBL: ENSMUSP00000101057 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048]

AlphaFold

Q8BWT5

Predicted Effect

probably damaging
Transcript: ENSMUST00000036033
AA Change: S93P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: S93P

Domain	Start	End	E-Value	Type
DMAP_binding	9	122	2.55e-35	SMART
low complexity region	173	208	N/A	INTRINSIC
low complexity region	281	293	N/A	INTRINSIC
Pfam:AMP-binding	330	806	4.3e-26	PFAM
Pfam:AMP-binding	982	1456	1.4e-52	PFAM
low complexity region	1487	1498	N/A	INTRINSIC
low complexity region	1511	1532	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105417
AA Change: S93P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: S93P

Domain	Start	End	E-Value	Type
DMAP_binding	9	122	2.55e-35	SMART
low complexity region	173	208	N/A	INTRINSIC
low complexity region	281	293	N/A	INTRINSIC
Pfam:AMP-binding	330	806	6.6e-28	PFAM
Pfam:AMP-binding	992	1466	7.3e-65	PFAM
low complexity region	1497	1508	N/A	INTRINSIC
low complexity region	1521	1542	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160048

SMART Domains

Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231

Domain	Start	End	E-Value	Type
DMAP_binding	9	83	7.94e-23	SMART
low complexity region	134	169	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
Pfam:AMP-binding	291	767	5.3e-26	PFAM
Pfam:AMP-binding	943	1417	1.7e-52	PFAM
low complexity region	1448	1459	N/A	INTRINSIC
low complexity region	1472	1493	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162766

Meta Mutation Damage Score

0.4532

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,233	D591G	probably benign	Het
9930012K11Rik	T	A	14: 70,155,943	H299L	probably damaging	Het
Abcb4	C	T	5: 8,935,180	A687V	probably benign	Het
Adam20	A	G	8: 40,795,011	T53A	probably benign	Het
Afg1l	G	A	10: 42,454,494	T59I	probably benign	Het
AI837181	A	G	19: 5,426,301	Q164R	probably benign	Het
Anapc15	T	A	7: 101,897,767	I12N	probably benign	Het
Ankrd55	A	C	13: 112,363,454	E278D	probably benign	Het
Axin2	A	G	11: 108,942,299	T437A	probably benign	Het
BC051665	T	C	13: 60,784,081	D168G	probably damaging	Het
Btbd11	A	G	10: 85,629,266	T657A	probably damaging	Het
Cd200	C	T	16: 45,392,301	R261H	probably benign	Het
Clk1	G	A	1: 58,421,102	S123L	probably benign	Het
Csrnp2	A	T	15: 100,484,690	D156E	probably damaging	Het
Ctss	C	T	3: 95,545,384	Q159*	probably null	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ephb6	G	A	6: 41,616,809	R542Q	probably benign	Het
Fmo3	T	C	1: 162,954,311	D491G	possibly damaging	Het
Galnt14	A	T	17: 73,536,893	M140K	probably benign	Het
Ghsr	T	C	3: 27,371,837	V14A	probably benign	Het
Gm17546	C	A	15: 95,829,962		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hc	A	G	2: 35,019,670	V866A	probably benign	Het
Hoxb6	G	A	11: 96,299,522	G116R	probably damaging	Het
Hykk	A	G	9: 54,920,606	Y43C	probably damaging	Het
Jade2	T	C	11: 51,821,148	T495A	probably benign	Het
Kansl1	A	T	11: 104,342,972	V755E	possibly damaging	Het
Lrp2	T	A	2: 69,479,113	D2814V	probably damaging	Het
Mbd5	T	A	2: 49,256,997	N406K	probably damaging	Het
Met	A	T	6: 17,491,929	D230V	probably damaging	Het
Mrgprx2	A	T	7: 48,482,836	V78D	probably damaging	Het
Mrpl20	A	G	4: 155,808,536	T112A	possibly damaging	Het
Nek11	T	A	9: 105,163,163	E566D	probably damaging	Het
Nostrin	T	C	2: 69,175,579	S235P	probably damaging	Het
Npas4	C	A	19: 4,986,777	S453I	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Psg18	A	T	7: 18,350,786	Y128*	probably null	Het
Ptges3l	A	T	11: 101,419,184		probably benign	Het
Pus1	T	C	5: 110,779,930		probably benign	Het
Raf1	T	A	6: 115,644,583	S12C	possibly damaging	Het
Rps6-ps2	T	G	8: 88,806,578		noncoding transcript	Het
Slc5a4b	A	G	10: 76,062,239	L547P	probably damaging	Het
Socs3	A	G	11: 117,967,828	S135P	probably benign	Het
St5	C	A	7: 109,556,836	E236*	probably null	Het
Stra6l	G	A	4: 45,873,682	V281M	possibly damaging	Het
Suco	G	A	1: 161,834,408	T818I	possibly damaging	Het
Syde1	A	T	10: 78,588,897	V367D	probably damaging	Het
Tet3	A	T	6: 83,376,883	L932*	probably null	Het
Trpm7	G	A	2: 126,813,185	L1278F	possibly damaging	Het
Vmn1r168	A	T	7: 23,541,065	T116S	probably damaging	Het
Wfdc6b	A	G	2: 164,617,294	Q92R	possibly damaging	Het

Other mutations in Dip2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Dip2a	APN	10	76313236	missense	probably benign
IGL00849:Dip2a	APN	10	76292318	missense	probably damaging	0.99
IGL01685:Dip2a	APN	10	76327749	missense	probably damaging	1.00
IGL01825:Dip2a	APN	10	76272680	nonsense	probably null
IGL02343:Dip2a	APN	10	76319478	missense	probably benign	0.00
IGL02437:Dip2a	APN	10	76298267	missense	probably benign	0.09
IGL02981:Dip2a	APN	10	76276421	missense	possibly damaging	0.84
IGL03122:Dip2a	APN	10	76275046	missense	probably benign	0.00
IGL03261:Dip2a	APN	10	76305148	missense	possibly damaging	0.80
R0369:Dip2a	UTSW	10	76298787	missense	probably damaging	1.00
R0522:Dip2a	UTSW	10	76321531	missense	probably benign	0.03
R0962:Dip2a	UTSW	10	76292432	unclassified	probably benign
R1164:Dip2a	UTSW	10	76276397	missense	possibly damaging	0.72
R1309:Dip2a	UTSW	10	76279776	missense	probably damaging	1.00
R1426:Dip2a	UTSW	10	76279820	unclassified	probably benign
R1636:Dip2a	UTSW	10	76321578	missense	probably benign	0.01
R1823:Dip2a	UTSW	10	76278502	nonsense	probably null
R1830:Dip2a	UTSW	10	76317963	missense	probably damaging	1.00
R1876:Dip2a	UTSW	10	76318091	missense	probably damaging	1.00
R2284:Dip2a	UTSW	10	76313193	missense	probably benign	0.01
R2369:Dip2a	UTSW	10	76313196	missense	probably benign
R4050:Dip2a	UTSW	10	76278607	missense	probably damaging	1.00
R4089:Dip2a	UTSW	10	76278489	splice site	probably null
R4231:Dip2a	UTSW	10	76319470	missense	probably damaging	1.00
R4715:Dip2a	UTSW	10	76296406	missense	probably benign	0.34
R4752:Dip2a	UTSW	10	76276657	missense	probably damaging	1.00
R4849:Dip2a	UTSW	10	76294533	missense	probably damaging	1.00
R4892:Dip2a	UTSW	10	76280759	missense	probably benign	0.02
R4998:Dip2a	UTSW	10	76319556	nonsense	probably null
R5068:Dip2a	UTSW	10	76318043	missense	possibly damaging	0.82
R5141:Dip2a	UTSW	10	76270453	missense	probably damaging	1.00
R5253:Dip2a	UTSW	10	76299997	missense	probably damaging	1.00
R5304:Dip2a	UTSW	10	76294523	missense	possibly damaging	0.67
R5324:Dip2a	UTSW	10	76296393	missense	probably damaging	1.00
R5369:Dip2a	UTSW	10	76292360	missense	probably damaging	1.00
R6272:Dip2a	UTSW	10	76286407	makesense	probably null
R6884:Dip2a	UTSW	10	76272532	critical splice donor site	probably null
R7143:Dip2a	UTSW	10	76297791	missense	probably damaging	1.00
R7247:Dip2a	UTSW	10	76272532	critical splice donor site	probably null
R7252:Dip2a	UTSW	10	76273202	missense	not run
R7327:Dip2a	UTSW	10	76272562	missense	probably benign	0.41
R7334:Dip2a	UTSW	10	76274246	missense	possibly damaging	0.91
R7349:Dip2a	UTSW	10	76285592	missense	probably damaging	1.00
R7360:Dip2a	UTSW	10	76278560	missense	probably damaging	1.00
R7513:Dip2a	UTSW	10	76313235	missense	probably benign
R7793:Dip2a	UTSW	10	76278583	missense	probably benign	0.06
R7794:Dip2a	UTSW	10	76276625	missense	probably damaging	1.00
R7819:Dip2a	UTSW	10	76291028	missense	probably benign	0.06
R8079:Dip2a	UTSW	10	76287321	missense	probably benign
R8280:Dip2a	UTSW	10	76264776	missense	possibly damaging	0.75
R8281:Dip2a	UTSW	10	76276604	missense	probably damaging	1.00
R8286:Dip2a	UTSW	10	76286463	missense	probably benign
R8350:Dip2a	UTSW	10	76264856	missense	probably damaging	1.00
R8450:Dip2a	UTSW	10	76264856	missense	probably damaging	1.00
R8525:Dip2a	UTSW	10	76274281	critical splice acceptor site	probably null
R8824:Dip2a	UTSW	10	76278486	critical splice donor site	probably null
R8897:Dip2a	UTSW	10	76274264	missense	probably benign	0.22
R9039:Dip2a	UTSW	10	76327719	missense	probably benign	0.00
R9286:Dip2a	UTSW	10	76302262	missense	probably benign	0.05
R9504:Dip2a	UTSW	10	76296355	missense	probably damaging	1.00
R9523:Dip2a	UTSW	10	76276604	missense	probably damaging	1.00
R9628:Dip2a	UTSW	10	76307159	missense	probably damaging	0.99
R9732:Dip2a	UTSW	10	76274243	missense	probably benign	0.11
Z1088:Dip2a	UTSW	10	76285628	missense	probably benign	0.06
Z1176:Dip2a	UTSW	10	76266323	missense	possibly damaging	0.94
Z1176:Dip2a	UTSW	10	76280820	missense	probably damaging	0.97
Z1177:Dip2a	UTSW	10	76266322	missense	possibly damaging	0.51
Z1177:Dip2a	UTSW	10	76296400	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATGCAAGCAATATGTGAG -3'
(R):5'- TGCACACTGTTTCAAATGGG -3'

Sequencing Primer
(F):5'- GTTCCAGGACATTCAGGGTTACAC -3'
(R):5'- CAAATGGGGCTTTTTATAATGGGAAC -3'

Posted On

2016-03-01