Incidental Mutation 'R4846:Jade2'
ID372178
Institutional Source Beutler Lab
Gene Symbol Jade2
Ensembl Gene ENSMUSG00000020387
Gene Namejade family PHD finger 2
SynonymsPhf15, 1200017K05Rik
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4846 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location51813455-51857653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51821148 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 495 (T495A)
Ref Sequence ENSEMBL: ENSMUSP00000104719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020655] [ENSMUST00000109090] [ENSMUST00000109091]
Predicted Effect probably benign
Transcript: ENSMUST00000020655
AA Change: T495A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020655
Gene: ENSMUSG00000020387
AA Change: T495A

DomainStartEndE-ValueType
Pfam:EPL1 39 177 3.4e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109090
AA Change: T495A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104718
Gene: ENSMUSG00000020387
AA Change: T495A

DomainStartEndE-ValueType
Pfam:EPL1 39 177 2e-17 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109091
AA Change: T495A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104719
Gene: ENSMUSG00000020387
AA Change: T495A

DomainStartEndE-ValueType
Pfam:EPL1 2 176 9.6e-9 PFAM
PHD 201 247 1.35e-10 SMART
PHD 310 365 1.74e-4 SMART
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hoxb6 G A 11: 96,299,522 G116R probably damaging Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Jade2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Jade2 APN 11 51825338 missense possibly damaging 0.95
IGL01935:Jade2 APN 11 51828384 missense possibly damaging 0.95
IGL02885:Jade2 APN 11 51831296 missense probably damaging 1.00
IGL02987:Jade2 APN 11 51830481 missense probably damaging 1.00
IGL02990:Jade2 APN 11 51831247 splice site probably benign
IGL03172:Jade2 APN 11 51825371 missense probably damaging 1.00
R0116:Jade2 UTSW 11 51831309 missense probably damaging 1.00
R1917:Jade2 UTSW 11 51818538 missense possibly damaging 0.95
R3410:Jade2 UTSW 11 51817223 missense probably benign
R3886:Jade2 UTSW 11 51830499 missense possibly damaging 0.79
R4916:Jade2 UTSW 11 51817082 missense probably benign 0.01
R5420:Jade2 UTSW 11 51818607 missense probably benign 0.21
R5446:Jade2 UTSW 11 51816959 missense probably benign
R5657:Jade2 UTSW 11 51816987 missense probably damaging 1.00
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6031:Jade2 UTSW 11 51826586 nonsense probably null
R6116:Jade2 UTSW 11 51835633 missense probably damaging 0.99
R7039:Jade2 UTSW 11 51828359 missense probably damaging 0.97
R7270:Jade2 UTSW 11 51817184 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCCCACGTGGATCTGTTATGTC -3'
(R):5'- AGATACTCCCTGCATGCTCAG -3'

Sequencing Primer
(F):5'- ATCTGTTATGTCCGTGAGAAGGAACC -3'
(R):5'- CTCAATTGTCTTAAGGCAGAGGG -3'
Posted On2016-03-01