Incidental Mutation 'R4846:Hoxb6'
ID 372179
Institutional Source Beutler Lab
Gene Symbol Hoxb6
Ensembl Gene ENSMUSG00000000690
Gene Name homeobox B6
Synonyms Hox-2.2
MMRRC Submission 042459-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock # R4846 (G1)
Quality Score 140
Status Validated
Chromosome 11
Chromosomal Location 96292476-96301569 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 96299522 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 116 (G116R)
Ref Sequence ENSEMBL: ENSMUSP00000133281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000704] [ENSMUST00000049272] [ENSMUST00000173432]
AlphaFold P09023
Predicted Effect probably damaging
Transcript: ENSMUST00000000704
AA Change: G116R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000704
Gene: ENSMUSG00000000690
AA Change: G116R

DomainStartEndE-ValueType
low complexity region 54 71 N/A INTRINSIC
HOX 146 208 1.49e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049272
SMART Domains Protein: ENSMUSP00000035423
Gene: ENSMUSG00000038700

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 135 158 N/A INTRINSIC
HOX 194 256 1.63e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150698
Predicted Effect probably damaging
Transcript: ENSMUST00000173432
AA Change: G116R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133281
Gene: ENSMUSG00000000690
AA Change: G116R

DomainStartEndE-ValueType
low complexity region 54 71 N/A INTRINSIC
HOX 146 208 1.49e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190470
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development, including that of lung and skin, and has been localized to both the nucleus and cytoplasm. Altered expression of this gene or a change in the subcellular localization of its protein is associated with some cases of acute myeloid leukemia and colorectal cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit an anteriorizing homeotic transformation of the cervicothoracic vertebrae C6-T1, and frequently a missing first rib and a bifid second rib. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,233 D591G probably benign Het
9930012K11Rik T A 14: 70,155,943 H299L probably damaging Het
Abcb4 C T 5: 8,935,180 A687V probably benign Het
Adam20 A G 8: 40,795,011 T53A probably benign Het
Afg1l G A 10: 42,454,494 T59I probably benign Het
AI837181 A G 19: 5,426,301 Q164R probably benign Het
Anapc15 T A 7: 101,897,767 I12N probably benign Het
Ankrd55 A C 13: 112,363,454 E278D probably benign Het
Axin2 A G 11: 108,942,299 T437A probably benign Het
BC051665 T C 13: 60,784,081 D168G probably damaging Het
Btbd11 A G 10: 85,629,266 T657A probably damaging Het
Cd200 C T 16: 45,392,301 R261H probably benign Het
Clk1 G A 1: 58,421,102 S123L probably benign Het
Csrnp2 A T 15: 100,484,690 D156E probably damaging Het
Ctss C T 3: 95,545,384 Q159* probably null Het
Dip2a A G 10: 76,321,493 S93P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ephb6 G A 6: 41,616,809 R542Q probably benign Het
Fmo3 T C 1: 162,954,311 D491G possibly damaging Het
Galnt14 A T 17: 73,536,893 M140K probably benign Het
Ghsr T C 3: 27,371,837 V14A probably benign Het
Gm17546 C A 15: 95,829,962 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hc A G 2: 35,019,670 V866A probably benign Het
Hykk A G 9: 54,920,606 Y43C probably damaging Het
Jade2 T C 11: 51,821,148 T495A probably benign Het
Kansl1 A T 11: 104,342,972 V755E possibly damaging Het
Lrp2 T A 2: 69,479,113 D2814V probably damaging Het
Mbd5 T A 2: 49,256,997 N406K probably damaging Het
Met A T 6: 17,491,929 D230V probably damaging Het
Mrgprx2 A T 7: 48,482,836 V78D probably damaging Het
Mrpl20 A G 4: 155,808,536 T112A possibly damaging Het
Nek11 T A 9: 105,163,163 E566D probably damaging Het
Nostrin T C 2: 69,175,579 S235P probably damaging Het
Npas4 C A 19: 4,986,777 S453I probably benign Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Psg18 A T 7: 18,350,786 Y128* probably null Het
Ptges3l A T 11: 101,419,184 probably benign Het
Pus1 T C 5: 110,779,930 probably benign Het
Raf1 T A 6: 115,644,583 S12C possibly damaging Het
Rps6-ps2 T G 8: 88,806,578 noncoding transcript Het
Slc5a4b A G 10: 76,062,239 L547P probably damaging Het
Socs3 A G 11: 117,967,828 S135P probably benign Het
St5 C A 7: 109,556,836 E236* probably null Het
Stra6l G A 4: 45,873,682 V281M possibly damaging Het
Suco G A 1: 161,834,408 T818I possibly damaging Het
Syde1 A T 10: 78,588,897 V367D probably damaging Het
Tet3 A T 6: 83,376,883 L932* probably null Het
Trpm7 G A 2: 126,813,185 L1278F possibly damaging Het
Vmn1r168 A T 7: 23,541,065 T116S probably damaging Het
Wfdc6b A G 2: 164,617,294 Q92R possibly damaging Het
Other mutations in Hoxb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Hoxb6 APN 11 96300809 missense probably damaging 0.96
IGL01784:Hoxb6 APN 11 96300813 missense probably damaging 1.00
R4945:Hoxb6 UTSW 11 96299259 missense possibly damaging 0.61
R4993:Hoxb6 UTSW 11 96300711 missense probably damaging 1.00
R5566:Hoxb6 UTSW 11 96300754 nonsense probably null
R7286:Hoxb6 UTSW 11 96292825 start gained probably benign
R7341:Hoxb6 UTSW 11 96299569 missense probably damaging 1.00
R7422:Hoxb6 UTSW 11 96292684 start gained probably benign
R8556:Hoxb6 UTSW 11 96300717 missense probably damaging 1.00
R9229:Hoxb6 UTSW 11 96300819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTACTCGTCTGGCTATG -3'
(R):5'- GATGCCCACCTAGTTCCCAATG -3'

Sequencing Primer
(F):5'- TACTCGTCTGGCTATGCGGAC -3'
(R):5'- CAATGGGAGAATTGGGGTTGG -3'
Posted On 2016-03-01