Mutagenetix > Incidental Mutations

Incidental Mutation 'R4846:Kansl1'

372181

Institutional Source

Beutler Lab

Gene Symbol

Kansl1

Ensembl Gene

ENSMUSG00000018412

Gene Name

KAT8 regulatory NSL complex subunit 1

Synonyms

1700081L11Rik

MMRRC Submission

042459-MU

Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4846 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104333229-104468861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 104342972 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 755 (V755E)

Ref Sequence

ENSEMBL: ENSMUSP00000102585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977]

Predicted Effect

probably benign
Transcript: ENSMUST00000018556

SMART Domains

Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000069188

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106971
AA Change: V755E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: V755E

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106972
AA Change: V755E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: V755E

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106977

SMART Domains

Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Meta Mutation Damage Score

0.0726

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]

Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,233	D591G	probably benign	Het
9930012K11Rik	T	A	14: 70,155,943	H299L	probably damaging	Het
Abcb4	C	T	5: 8,935,180	A687V	probably benign	Het
Adam20	A	G	8: 40,795,011	T53A	probably benign	Het
Afg1l	G	A	10: 42,454,494	T59I	probably benign	Het
AI837181	A	G	19: 5,426,301	Q164R	probably benign	Het
Anapc15	T	A	7: 101,897,767	I12N	probably benign	Het
Ankrd55	A	C	13: 112,363,454	E278D	probably benign	Het
Axin2	A	G	11: 108,942,299	T437A	probably benign	Het
BC051665	T	C	13: 60,784,081	D168G	probably damaging	Het
Btbd11	A	G	10: 85,629,266	T657A	probably damaging	Het
Cd200	C	T	16: 45,392,301	R261H	probably benign	Het
Clk1	G	A	1: 58,421,102	S123L	probably benign	Het
Csrnp2	A	T	15: 100,484,690	D156E	probably damaging	Het
Ctss	C	T	3: 95,545,384	Q159*	probably null	Het
Dip2a	A	G	10: 76,321,493	S93P	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dync1h1	C	A	12: 110,658,126	T3700N	probably damaging	Het
Ephb6	G	A	6: 41,616,809	R542Q	probably benign	Het
Fmo3	T	C	1: 162,954,311	D491G	possibly damaging	Het
Galnt14	A	T	17: 73,536,893	M140K	probably benign	Het
Ghsr	T	C	3: 27,371,837	V14A	probably benign	Het
Gm17546	C	A	15: 95,829,962		probably benign	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Hc	A	G	2: 35,019,670	V866A	probably benign	Het
Hoxb6	G	A	11: 96,299,522	G116R	probably damaging	Het
Hykk	A	G	9: 54,920,606	Y43C	probably damaging	Het
Jade2	T	C	11: 51,821,148	T495A	probably benign	Het
Lrp2	T	A	2: 69,479,113	D2814V	probably damaging	Het
Mbd5	T	A	2: 49,256,997	N406K	probably damaging	Het
Met	A	T	6: 17,491,929	D230V	probably damaging	Het
Mrgprx2	A	T	7: 48,482,836	V78D	probably damaging	Het
Mrpl20	A	G	4: 155,808,536	T112A	possibly damaging	Het
Nek11	T	A	9: 105,163,163	E566D	probably damaging	Het
Nostrin	T	C	2: 69,175,579	S235P	probably damaging	Het
Npas4	C	A	19: 4,986,777	S453I	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Psg18	A	T	7: 18,350,786	Y128*	probably null	Het
Ptges3l	A	T	11: 101,419,184		probably benign	Het
Pus1	T	C	5: 110,779,930		probably benign	Het
Raf1	T	A	6: 115,644,583	S12C	possibly damaging	Het
Rps6-ps2	T	G	8: 88,806,578		noncoding transcript	Het
Slc5a4b	A	G	10: 76,062,239	L547P	probably damaging	Het
Socs3	A	G	11: 117,967,828	S135P	probably benign	Het
St5	C	A	7: 109,556,836	E236*	probably null	Het
Stra6l	G	A	4: 45,873,682	V281M	possibly damaging	Het
Suco	G	A	1: 161,834,408	T818I	possibly damaging	Het
Syde1	A	T	10: 78,588,897	V367D	probably damaging	Het
Tet3	A	T	6: 83,376,883	L932*	probably null	Het
Trpm7	G	A	2: 126,813,185	L1278F	possibly damaging	Het
Vmn1r168	A	T	7: 23,541,065	T116S	probably damaging	Het
Wfdc6b	A	G	2: 164,617,294	Q92R	possibly damaging	Het

Other mutations in Kansl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Kansl1	APN	11	104424466	missense	probably damaging	0.96
IGL00658:Kansl1	APN	11	104357526	missense	probably benign	0.10
IGL00688:Kansl1	APN	11	104425066	missense	probably damaging	1.00
IGL01121:Kansl1	APN	11	104335596	missense	probably benign	0.01
IGL01624:Kansl1	APN	11	104424552	missense	probably benign	0.13
IGL02187:Kansl1	APN	11	104378831	splice site	probably null
IGL02711:Kansl1	APN	11	104335575	missense	probably damaging	1.00
IGL02965:Kansl1	APN	11	104335165	missense	probably damaging	0.99
kansas	UTSW	11	104424132	missense	possibly damaging	0.94
wichita	UTSW	11	104356767	missense	possibly damaging	0.90
NA:Kansl1	UTSW	11	104342367	missense	probably benign	0.09
R0399:Kansl1	UTSW	11	104424132	missense	possibly damaging	0.94
R0611:Kansl1	UTSW	11	104338186	missense	probably benign	0.31
R0665:Kansl1	UTSW	11	104343538	missense	probably benign
R0667:Kansl1	UTSW	11	104343538	missense	probably benign
R0747:Kansl1	UTSW	11	104342976	missense	probably benign	0.00
R0865:Kansl1	UTSW	11	104424368	missense	probably benign	0.08
R1479:Kansl1	UTSW	11	104342416	missense	probably damaging	1.00
R1679:Kansl1	UTSW	11	104423996	missense	probably damaging	1.00
R1818:Kansl1	UTSW	11	104342457	missense	possibly damaging	0.80
R1922:Kansl1	UTSW	11	104343640	missense	probably damaging	1.00
R1932:Kansl1	UTSW	11	104335097	missense	probably damaging	0.99
R2105:Kansl1	UTSW	11	104335559	missense	probably damaging	0.98
R2907:Kansl1	UTSW	11	104424460	missense	possibly damaging	0.82
R3935:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R3936:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R4282:Kansl1	UTSW	11	104378689	missense	probably benign	0.19
R4455:Kansl1	UTSW	11	104424358	missense	possibly damaging	0.47
R4696:Kansl1	UTSW	11	104356767	missense	possibly damaging	0.90
R4890:Kansl1	UTSW	11	104343042	missense	probably benign
R4973:Kansl1	UTSW	11	104424321	missense	probably damaging	1.00
R4975:Kansl1	UTSW	11	104335564	missense	probably damaging	1.00
R5085:Kansl1	UTSW	11	104424342	missense	probably damaging	1.00
R5227:Kansl1	UTSW	11	104356814	missense	probably benign	0.19
R5310:Kansl1	UTSW	11	104424858	missense	possibly damaging	0.95
R5652:Kansl1	UTSW	11	104338166	missense	probably damaging	1.00
R5677:Kansl1	UTSW	11	104335148	missense	probably benign	0.00
R5980:Kansl1	UTSW	11	104343637	missense	possibly damaging	0.96
R6013:Kansl1	UTSW	11	104350639	missense	probably benign	0.00
R6253:Kansl1	UTSW	11	104357526	missense	probably benign	0.10
R7751:Kansl1	UTSW	11	104424064	missense	probably benign	0.30
R7880:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7888:Kansl1	UTSW	11	104342422	missense	probably benign	0.00
R7935:Kansl1	UTSW	11	104424286	missense	probably damaging	0.99
R8251:Kansl1	UTSW	11	104424360	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTAGCAAGTGATGGACAAAGC -3'
(R):5'- TGCTGCCCTGAGTATATAGCC -3'

Sequencing Primer
(F):5'- TGATGGACAAAGCTTGGGTTAG -3'
(R):5'- CCCTGAGTATATAGCCTTAGGAGTAC -3'

Posted On

2016-03-01